Friday, September 20, 2019

Epigenetic Control of Endocannabinoid Function

Epigenetic Control of Endocannabinoid Function Janis Szeremeta Epigenetic control of endocannabinoid function Prostate cancer is one of the most frequently diagnosed types of tumours in the male population worldwide. The endocannabinoid system, more specifically high expression of cannabinoid receptor 1 (CB1) in tumour tissue, has been associated with poor prognosis in prostate cancer and suggested as a prognostic marker. Epigenetic silencing has previously been shown to upregulate CB1 mRNA expression in colon cancer cell lines and to induce expression of normally silenced cannabinoid receptor 2 (CB2) mRNA in a neuroblastoma cell line. In the present study, potential effects of epigenetic modulation on the expression of 12 different components of the endocannabinoid system (receptors, synthetic and catabolic enzymes) were investigated in a prostate cancer and a neuroblastoma cell line. Additionally, two catabolic pathways were investigated in functional assays. In general, changes in mRNA expression levels produced by treatment with the epigenetic modulators, 5-aza-2-deoxycytidine and Tricho statin A were small, and, in the case of the catabolic enzyme fatty acid amide hydrolase in DU-145 prostate cancer cells were not accompanied by observable changes in hydrolysis rates. In SH-SY5Y neuroblastoma cells a low expression of monoacylglycerol lipase was found and this was also observed in functional assays. It is concluded that for the cell lines investigated, the epigenetic modulators tested do not modify the endocannabinoid system to any obvious degree, at least at the mRNA level. Since these experiments were conducted on a single cell line of a specific cell type only, introduction of alternative prostate cancer cell lines, such as PC-3 or LNCaP, might have different outcomes and should be considered for future experiments. Due to its involvement in a variety of physiological and pathophysiological conditions, such as obesity, pain, immunomodulation and cancer1, the endocannabinoid system has emerged as an important area of research. Endogenous lipid transmitters, the so-called endocannabinoids, act by binding and activating the G-protein coupled cannabinoid receptors 1 and 2 (CB1/ CB2). Endocannabinoid levels are tightly regulated by a network of synthesizing and catabolizing enzymes (Figure 1). Two lipid mediators, N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoylglycerol (2-AG), remain the most thoroughly studied endocannabinoids to date. 2-AG is derived from hydrolysis of diacylglycerols (DAGs) containing arachidonic acid via diacylglycerol lipases ÃŽÂ ± and ÃŽÂ ² (DGLÃŽÂ ±/ÃŽÂ ²) and then hydrolysed to arachidonic acid mainly via monoacylglycerol lipase (MGL) but also by ÃŽÂ ±/ÃŽÂ ²-hydrolase domain containing 6 and 12 (ABHD6, ABHD12)2. AEA is derived from N-acylphos phatidylethanolamines (NAPEs) by hydrolysis via NAPE-phospholipase D (NAPE-PLD). It is inactivated by hydrolysis via fatty acid amide hydrolase (FAAH) and N-acylethanolamine acid amide hydrolase (NAAA) to arachidonic acid. Arachidonic acid is a substrate for many enzymes, including cyclooxygenase (COX) -1 and -2, 5- and 12-lipoxygenases (5/12-LOX) to produce prostaglandins, 5- and 12- hydroxyicosatetraenoic acid (5/12-HETE), respectively. Both 2-AG and AEA can also be hydrolysed to prostaglandin H2 derivatives via COX-23. Current modulators of the endocannabinoid system include a variety of selective pharmacological inhibitors for these enzymes which can be used to study their functional roles in the body (see Figure 1 for compounds used in this study). Figure 1: Simplified view of the endocannabinoid system. G-protein coupled receptors CB1 and CB2 are activated by lipid mediators, in this case 2-AG and anandamide (AEA) as well as by plant derived and synthetic compounds (not depicted). 2-AG and AEA are synthesized from diacylglycerol or N-acylphosphatidylethanolamine precursors and act locally. Both messengers are hydrolysed to arachidonic acid and/or prostaglandin H2 derivatives. Descriptions given in green were investigated towards changes in mRNA expression following epigenetic modulation treatment. Descriptions given in red show endocannabinoid metabolizing enzyme inhibitors. Abbreviations: Penta, Pentadecylamine (after Muccioli 20103). The endocannabinoid system is becoming a more and more important therapeutic target in cancer, and very interestingly, different types of cancer appear to react differently to changes in endocannabinoid balance, with oftentimes opposing effects ranging for example from pro- to antiapoptotic4. This shows why understanding how the endocannabinoid system is regulated in health and disease remains an important part of research. An important hallmark of cancer formation of cancer is the occurrence of epigenetic alterations5,6. Aberrant DNA methylation has been found in various types of cancer and effects vary between hyper- and hypomethylation states and in different types of cancer (see Kulis et al 20107). DNA methylation is usually associated with inhibition of gene expression. Cytosine nucleotides are methylated at the fifth carbon to form 5-methylcytosine, which can hinder transcription factor binding and therefore interfere with gene expression8. 5-Aza-2-deoxycytidine is a DNA demethylation compound that is able to replace and mimic cytosine in the DNA. In case of a cytosine replacement, DNA methyltransferases (DNMTs), that would normally catalyse methylation of cytosines, will now be bound covalently to 5-Aza-2-deoxycytidine, leading to degradation and depletion of DNMT protein levels and therefore a decrease of DNA methylation9. Note that this process is unspecific and generally decreases overall DNA methylation. Histone acetylation, a different type of epigenetic modification, is associated with activation of gene transcription. Occurring on lysine residues of histones, histone acetylation is associated with a charge neutralization of the positively charged histone molecules. This neutralization reaction is thought to decrease interaction between negatively charged DNA phosphate backbones and their positively charged histone counterparts, therefore increasing DNA availability10. Histone acetylation is regulated by an interplay of histone acetylases (HATs) and histone deacetylases (HDACs)11. Inhibition of HDACs may be used to constitutively activate histone acetylation mediated gene expression. Prostate cancer has become one of the most frequently diagnosed malignancies in men throughout Europe12. Current evidence suggests that high a CB1 receptor immunoreactivity is correlated to disease severity and outcome13. Several prostate cancer cell lines and human prostate cancer tissues have been shown to express CB1 receptors using various techniques, such as qPCR, immunofluorescence and western blotting13-16. There is evidence that CB1 expression is regulated epigenetically in colorectal cancer, where DNA hypermethylation lead to a loss of CB1 expression17. The same study found inhibition of epigenetic silencing (i.e. removal of DNA methylation) increased Cnr1 mRNA expression in seven out of eight colorectal cancer cell lines. A different study investigated the effects of two different epigenetic modulators, 5-Aza-2-deoxycytidine (Aza dC) and Trichostatin A (TSA), a histone deacetylase inhibitor, upon CB receptor expression in two different cell lines18. Inhibition of epigenetic silencing in Jurkat T cells increased Cnr1 mRNA expression in an additive manner but did not affect Cnr2 mRNA expression, whereas treatment of human SH-SY5Y neuroblastoma cells lead to induction of normally silenced Cnr2 mRNA expression, again in an additive manner, but no changes in Cnr1 mRNA. Whilst the above data implicate epigenetic regulation of CB receptors, it is not known whether it is seen in prostate cancer cells, and there is no data concerning the endocannabinoid synthetic and catabolic enzymes. In consequence, the present study investigated the effects of Aza dC and Trichostatin A treatment upon mRNA expression for 12 different endocannabinoid-related genes (see Figure 1). Differences that were found were investigated in hydrolysis experiments and changes in either AEA or 2-AG hydrolysis. In addition, since tumours are often located in hypoxic microenvironments19, cell lines were exposed to hypoxic conditions for increasing intervals up to 24 h and the same panel of endocannabinoid system components was investigated towards mRNA expression. Cells were either placed into anoxic incubation chambers or exposed to hypoxia mimetics such as Co(II)Cl220 or deferoxamine21. Drugs and Compounds Radiolabeled compounds ([3H]-2-OG (60 Ci/mmol)), [3H]-AEA (60 Ci/mmol)) were obtained from American Radiolabeled Chemicals Inc, St. Louis, MO, USA. URB597, JZL184, WWL70 were obtained from the Cayman Chemical Co. (Ann Arbor, MI, USA). Pentadecylamine, 5-Aza-2-deoxycytidine (Aza dC), Trichostatin A, Co(II)Cl2 were obtained from Sigma-Aldrich (St. Louis, MO, USA). Cell Culture Human DU-145 (prostate cancer, passage range 17 to 29) and SH-SY5Y (neuroblastoma, passage range 19 to 28) cells were expanded in Eagles Minimal Essential Medium (EMEM ATCC 30-2003) supplemented with penicillin, streptomycin (10,000 U/mL each, Gibco by Life Technologies) and 10% FBS (Gibco by Life Technologies) in 75 mL flasks at 37ËÅ ¡C with 5% atmospheric CO2. Cells were plated in 24 well plates with a total number of cells of 1.5 ÃÆ'- 105 for DU-145 and 2.5 ÃÆ'- 105 cells for SH-SY5Y per well overnight. Epigenetic Modulation using 5-Aza-2-deoxycytidine and Trichostatin A Following the overnight plating, DU-145 and SH-SY5Y cells were treated by replacing the old medium with a fresh layer of medium containing Aza dC (1  µM), Trichostatin A (25 nm), a combination of both, or vehicle (DMSO 0.1%) as control for 24 h. After 24 h hours, cells were lysed according to the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) instructions and mRNA was extracted. Exposure to Hypoxia/Hypoxia Mimetics Induction of hypoxia was achieved via two different methods. Cells were seeded into 24 well plates and either kept in a hypoxic environment or were exposed to the hypoxia mimetic Co(II)Cl2. A hypoxic atmosphere inside an airtight modular incubation chamber (Billups Rothenberg Inc, San Diego, CA, USA) was achieved by first flushing the medium with a hypoxic gas mix (1% O2, 99% CO2) at a rate of 3 L/min for 5 minutes. The old medium was replaced with a layer of flushed medium and plates were placed into the airtight chamber. The chamber was flushed with hypoxic gas at a rate of 20 L/min for 5 minutes (per manufacturers instructions22) and then incubated at 37ËÅ ¡C for either 2, 4, 6, 8 or 24 h. Co(II)Cl2 was used at a final concentration of 50 mM and cells were incubated for 2, 4, 6, 8 or 24 h. HIF1ÃŽÂ ± and HIF2ÃŽÂ ± mRNA levels were assessed for both procedures to evaluate induction of hypoxia. qPCR mRNA was extracted using the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit. mRNA (5  µg of total) was used for reverse transcription using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Thermo Fisher Scientific). qPCR reaction mixtures were prepared using the KAPA SYBR FAST qPCR Master Mix (2X, KAPA Biosystems, Wilmington, MA, USA) to a final Volume of 20  µL. Reactions were run on the Illumina Eco Real Time PCR system (Illumina Inc, San Diego, CA, USA) with an initial denaturation time of 10 minutes at 95ËÅ ¡C, 45 cycles of 10 seconds at 95ËÅ ¡C and 30 seconds at 60ËÅ ¡C and melting curve cycle times of 15 seconds at 95ËÅ ¡C, 15 seconds at 55ËÅ ¡C and a final step of 95ËÅ ¡C for an additional 15 seconds. Primers (Table 1) were synthesized at Integrated DNA Technologies (Coralville, IA, USA). Amounts of transcripts were normalized to ribosomal protein L19 (RPL19) and relative quantification was perf ormed using the ˆâ€  Ã‹â€ Ã¢â‚¬  Ct method. Table 1: primers used for qPCR experiments Gene Product Forward primer (5 to 3) Reverse primer (5 to 3) Abhd6 ABHD6 GATGTCCGCATCCCTCATAAC CCAGCACCTGGTCTTGTTTC Abhd12 ABHD12 GGCAGAAAGCTCTATAGCATCG CCTGTAGCCAAGGTCTGAATG Cnr1 CB1 CACCTTCCGCACCATCACCAC GTCTCCCGCAGTCATCTTCTCTTG Cnr2 CB2 1st pair CATGGAGGAATGCTGGGTGAC GAGGAAGGCGATGAACAGGAG CB2 2nd pair AAACAACTGGGACTCCTC GTCTAGAAGGCTTTGGGTTG Ptgs2 COX-2 AGCAGGCAGATGAAATACCAG ACCAGAAGGGCAGGATACA Dagla DAGLÃŽÂ ± CCCAAATGGCGGATCATCG GGCTGAGAGGGCTATAGTTAGG Daglb DAGLÃŽÂ ² TCAGGTGCTACGCCTTCTC TCACACTGAGCCTGGGAATC Faah FAAH CACACGCTGGTTCCCTTCTT GGGTCCACGAAATCACCTTTGA Hif1a HIF1ÃŽÂ ± GCTGATTTGTGAACCCATTCC TTCATATCCAGGCTGTGTCG Epas1 HIF2ÃŽÂ ± CACAGAGTTCTTGGGAGCAG ACCCTTTGCAGACCTTGTC Alox5 5-LOX ATCCAGCTCAACCAAATCCC ACCAGATGTGTTCGCAGAAG Alox12 12-LOX GATCCGAGGAGAGAAGCAATAC GGAGGCTGAATCTGGATGAC Alox15 15-LOX CGAGGGTTTCCTGTCTCTTTAC GCACCCAAGAGTACCAGTC Mgll MAGL GGAAACAGGACCTGAAGACC ACTGTCCGTCTGCATTGAC Naaa NAAA ATGGAGCGTGGTTCCGAGTT AGGCTGAGGTTTGCTTGTCCT Napepld NAPE-PLD ACTGGTTATTGCCCTGCTTT AATCCTTACAGCTTCTTCTGGG Rpl19 RPL19 CACATCCACAAGCTGAAGGCA CTTGCGTGCTTCCTTGGTCT [3H]-AEA Hydrolysis in DU-145 Cells The assay of Bjà ¶rklund et al. (2014)23 was used. Cells (1.5 ÃÆ'- 105 per well) were plated and kept overnight to allow for cell adherence. Subsequently, cells were treated with Aza dC (1  µM) for 24 h or left untreated as control. Non-enzymatic hydrolysis was measured in non-cell containing wells. Wells were washed with KRH buffer (120 mM NaCl, 4.7 mM KCl, 2.2 mM CaCl2.2H2O, 10 mM HEPES, 0.12 mM KH2PO4, 0.12 mM MgSO4 containing 1% BSA (Sigma Aldrich) followed by KRH buffer alone. KRH buffer containing 0.1% fatty-acid free BSA (Sigma Aldrich) was added to the wells and plates were kept in a water bath at 37ËÅ ¡C. Inhibitors (URB597 1  µM, Pentadecylamine 1  µM, URB597 and Pentadecylamine 1 µM each) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C. [3H]-AEA (diluted with non-radioactive AEA to give a final assay concentration of 0.5  µM) was added and plates were incubated for a further 15 minutes resulting in a total reaction vol ume of 400  µL. The hydrolysis reaction was stopped by adding 600  µL activated charcoal in 0.5 M hydrochloric acid and plates were kept on ice. Charcoal and aqueous phase were separated by centrifugation (2,500 rpm, 10 min.), 200  µL of the aqueous phase were recovered and mixed with 4 mL scintillation liquid (ULTIMA GOLD, PerkinElmer) for liquid scintillation radioactivity determination with quench correction. The [3H]-AEA used is labelled in the ethanolamine part of the molecule, and the [3H]-ethanolamine produced by the hydrolysis of [3H]-AEA does not adsorb to the charcoal, whereas the [3H]-AEA does adsorb24. [3H]-2-OG Hydrolysis in SH-SY5Y Cells Cells (2.5 ÃÆ'- 105 per well) were plated and incubated overnight to allow for cell adherence. Non-enzymatic hydrolysis was measured in non-cell containing wells. The assay used was the same as for [3H]-AEA hydrolysis, but using 0.5  µM [3H]-2-OG (labelled in the glycerol part of the molecule). Inhibitors (URB597 1  µM, JZL184 1  µM, WWL70 10  µM, a combination of URB597, JZL184 and WWL70 and a combination of JZL184 and WWL70 at the aforementioned concentrations) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C followed by addition of substrate and incubation for a further 15 min. See above for determination of radioactivity in aqueous phase. Cytotoxicity Assessment/Assay To determine the cytotoxicity of the various treatments throughout this project the LDH cytotoxicity detection kit from Roche (Cat. No. 11 644 793 001) was used per manufacturers protocol. Statistical Analyses Statistical analyses were undertaken by my Supervisor using the function ezANOVA in the package ez for the R statistical programme (R Core Team, URL http://www.R-project.org/). The details and the command lines used are given in Table 2. Epigenetic regulation of endocannabinoid function DU-145 and SH-SY5Y cells were treated for 24h with either Aza dC, TSA or a combination of both compounds, after which mRNA was extracted and analused for expression of marker of the endocannabinoid system. Table 2 shows the summarized data of the statistical analysis obtained in the gene expression studies. Main effects are given in the left half of the table. Significant differences were found for a various number of genes and are given in bold type. Main effects cell describes the comparison of gene expression between DU-145 and SH-SY5Y cells. The columns with Aza dC and TSA describe the effect of the epigenetic modulators on mRNA expression of the gene of interest and only a few of them were statistically significant (i.e. DGLÃŽÂ ² and FAAH for Aza dC and 12-LOX for TSA). Interpretation of the main effects is difficult when there are significant interactions. Values in bold type indicate an interaction between components) for four of the twelve genes of interest. In these cases, individual two-way ANOVAs helped to determine actual differences for each cell line per se. Results of these ANOVAs can be found below their corresponding figures (see Figure 2, Figure 3 and Figure 4) with a P Table 2: Three-way ANOVA summary for the PCR data. Main effects Interactions Cell: Cell: Cell: Aza dC: Aza dC: Protein Cell Aza dC TSA Aza dC TSA TSA TSA CB1 0.0003 0.31 0.060 0.38 0.89 0.14 0.30 NAPE-PLD 0.34 0.40 0.28 0.0093 0.29 0.29 0.54 DGLÃŽÂ ± 0.87 0.88 0.0049 0.49 0.16 0.61 DGLÃŽÂ ² 0.43 0.0004 0.027 0.020 0.031 0.88 0.96 FAAH 0.041 0.0061 0.55 0.17 0.85 NAAA 0.012 0.53 0.44 0.79 0.15 0.40 MGL 0.21 0.019 0.014 0.85 0.25 0.59 ABHD6 0.0004 0.019 0.15 0.0001 0.70 0.43 0.67 ABHD12 0.0078 0.014 0.65 0.091 0.14 0.61 0.11 COX2 0.032 0.62 0.21 0.70 0.83 0.74 5-LOX 0.99 0.45 0.21 0.91 0.98 0.13 0.53 12-LOX 0.0039 0.18 0.0001 0.41 0.55 0.93 0.69 Data shows the ANOVA p values for each protein, calculated for the data expressed as ˆâ€  Ct using the function ezANOVA in the package ez for the R statistical programme. The command line used was Model25). P values in bold type are those where significance remained after implementation of a 5% false discovery rate (Benjamini Hochberg, 199526). When the interaction cell type x Aza dC was significant, two-way ANOVA matching for Aza dC and TSA have been calculated for each cell type separately, and these are shown in the figures. Note that for DGLÃŽÂ ² and MGL the variances were different for the DU145 and SH-SY5Y cells and this will affect accuracy of the P values. In these cases, the cells have been analysed separately and the ANOVA values given in the figures. Cannabinoid receptors 1 and 2 Figure 2: Panel A, mRNA levels for CB1 receptors in DU145 and SH-SY5Y cells treated with Aza dC and/or TSA. The graphs show the individual ˆâ€  Ct values (bars show the means), N=6 per group (each assayed in triplicate), with the corresponding % of controls on the right column. For statistical treatment, see Table 2. Panel B, melting curves for the primers used for CB1 and CB2 receptors. The melting curves are for the DU145 cells. Gene expression analysis data of CB1 mRNA is given in Figure 2A. Expression rates were significantly different between the two cell lines, but neither Aza dC nor Trichostatin A had an effect. No interactions between the compounds and the cell types were found (Table 2) Unfortunately, two different primer pairs, designed to amplify Cnr2 mRNA did not give detectable and reproducible mRNA expression of CB2, so no expression data could be obtained for CB2 (Figure 1B). The first primer pair was taken from a previous publication by Bà ¶rner et al whereas the second pair was designed on site. Figure 1B shows the different melting curves obtained during the qPCR assays for DU-145, with similar results for SH-SY5Y cells. Endocannabinoid synthetic enzymes Figure 3: mRNA levels of the endocannabinoid synthetic enzymes NAPE-PLD (A), DGLÃŽÂ ± (B) and DGLÃŽÂ ² (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panels A and B) or when the variance was different for the two cell types (Panel C). Effects of epigenetic modulation on the expression of endocannabinoid synthetic enzymes are shown in Figure 2. No main effects of either Aza dC or TSA were detected for NAPE-PLD or DGLÃŽÂ ±, there was an interaction between the different cell types and the Aza dC treatment, however (see Table 2). For these samples a two-way ANOVA was calculated and values are given below each figure. Indiviual treatments did not have any significant effect on the expression of both NAPE-PLD and DGLÃŽÂ ± (Figure 2A and B), an additive effect of Aza dC and TSA could be observed for the expression of DGLÃŽÂ ± in DU-145 cells, where expression decreased to a small degree. For DGLÃŽÂ ², since the variance was different for both cell types, a two-way ANOVA was calculated for each. No significant effects were observed for DGLÃŽÂ ² expression in SH-SY5Y cells. However, both Aza dC and TSA had significant main effects in the DU-145 cells, although the sizes of the changes produced by the compou nds were very small (Figure 2C). AEA catabolic enzymes Figure 4: mRNA levels of the endocannabinoid catabolic enzymes FAAH (A) and NAAA (B). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel A). As seen in Table 2, Aza dC had both a significant main effect, but also displayed interaction between the cell types and the compound for FAAH. The two-way ANOVA for FAAH resulted in significant differences only for the Aza dC treatment in DU-145, but not in SH-SY5Y. Once again, the effects were very small in size. Trichsotatin A did not have an effect in either cell line, neither individually nor in combination (Figure 3A). No significant differences were found for NAAA (Figure 3B). 2-AG catabolic enzymes Figure 5: mRNA levels of the endocannabinoid catabolic enzymes MGL (A), ABHD6 (B) and ABHD12 (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel B) or when the variance was different for the two cell types (Panel A). Gene expression analysis of the three key enzym

Thursday, September 19, 2019

HOW TO USE CABLE NUT :: essays research papers

CABLENUT ADJUSTER v4.08 Copyright (C) 2000,2001 CableNut Software - www.cablenut.com ------------------------------------------------------ Frequently Asked Questions (FAQ): http://www.cablenut.com, has a frequently asked questions guide as well as other content about the CableNut Software. INSTALLATION: The CableNut Adjuster is compatible with Windows 95/98/98SE/ME/NT/2000/XP each CCS file is tagged with an Operating System specific tag to show what Operating System it is compatible for. Explanation of specific terms are found below. 2K = Windows NT/2000/XP supported 9X = Windows 95/98/98SE/ME supported Cable_normal = Cable connections that can support up to 250KB/sec Cable_fast = Cable connections that can support over 250KB/sec Adsl_normal = Adsl connections that do not have the 1.5Mbps speed package Adsl_fast = Adsl connections that can achieve 1.5Mbps speed, or more ------------------------------------------------------ ADJUSTER.EXE  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Main CableNut program CABLENUT.HLP CableNut help file UNINST-CABLENUT.EXE CableNut uninstaller OFFICIAL SITE.URL Official CableNut site README.TXT Software readme info ..CCS/ CableNut Custom Settings (CCS) sub-folder 56K/ 56K_9X.CCS Dialup 56K modem tweak file for Windows 95/98/98SE/ME 56K_2K.CCS Dialup 56K modem tweak file for Windows NT/2000/XP Cable/ CABLE_NORMAL_9X.CCS Cable broadband tweak file for Windows 95/98/98SE/ME CABLE_NORMAL_2K.CCS Cable broadband tweak file for Windows NT/2000/XP CABLE_FAST_9X.CCS Cable broadband tweak file for Windows 95/98/98SE/ME CABLE_FAST_2K.CCS Cable broadband tweak file for Windows NT/2000/XP Adsl/ ADSL_NORMAL_9X.CCS Adsl broadband tweak file for Windows 95/98/98SE/ME ADSL_NORMAL_2K.CCS Adsl broadband tweak file for Windows NT/2000/XP ADSL_FAST_9X.CCS Adsl broadband tweak file for Windows 95/98/98SE/ME ADSL_FAST_2K.CCS Adsl broadband tweak file for Windows NT/2000/XP Satellite/ SATELLITE_9X.CCS Satellite Internet tweak file for Windows 95/98/98SE/ME SATELLITE_2K.CCS Satellite Internet tweak file for Windows NT/2000/XP ------------------------------------------------------ GETTING STARTED: 1. Locate the CCS sub-folder in the CableNut folder. (This can either be done by the desktop shortcut, the start menu shortcut, or by locating the CableNut install folder.) ------------------------------------------------------ 2. Run the CableNut Adjuster program. (Adjuster.exe - shortcuts are on the desktop, and in the start menu.) ------------------------------------------------------ 3. Select 'Open Custom Settings File' from the file menu. (This will load a specific CCS file into the Adjuster.) ------------------------------------------------------ 4. Select the correct CCS file that corresponds to your Internet connection. (All of the CableNut CCS files are located in the CCS sub-folder.) ------------------------------------------------------ 5. Click open on your selected CCS file. ------------------------------------------------------ 6. The values for the specific CCS will show. ------------------------------------------------------ 7. Press the 'Save to Registry' button. ------------------------------------------------------ 8. This will install the selected CableNut tweak file. ------------------------------------------------------ 9. Restart your system. (A restart is needed after every change in the Adjuster.) ------------------------------------------------------ 10. Your system is now tweaked for optimal Internet speed.

Wednesday, September 18, 2019

Comparing the Foreign Policy of Presidents George W. Bush and Bill Clin

Comparing the Foreign Policy of Presidents George W. Bush and Bill Clinton Towards North Korea Since its creation after the Korean War in 1950, North Korea, also known as the Democratic People Republic of Korea (DPRK), has caused many problems for the United States. North Korea has, for instance, broken treaties and even gone so far as to threaten the use of nuclear weapons. Naturally, different presidents have dealt with North Korea in different ways. Take Eisenhower for example, he actually threatened the use of nuclear weapons against North Korea in 1953 (obviously before North Korea had nuclear capabilities). Many presidents ignored North Korea all together, and some tried to ignore the country, but circumstances did not allow it. Two such presidents, Bill Clinton and George W. Bush, the 42nd and 43rd presidents respectively also tried at the beginning of their tenure as president to ignore the brewing problems in North Korea. Their indifference towards North Korea, however, was cut short, and they were both forced to engage the country early on in their respective admini strations. Their decisions in dealing with North Korea would help to define their early reputations as foreign policy makers. Their circumstances for being drawn into the affairs of North Korea were remarkably different (Clinton getting drawn in because of the threat of nuclear capabilities and Bush getting drawn in because of terrorism) as were their approaches to North Korea. Many similarities can be seen between Bush and Clinton's dealings with North Korea. Clinton started out, as mentioned before, trying to altogether ignore some eminent problems brewing in North Korea. In his Essay "Clinton's Foreign Policy in Somalia, Bosnia, Haiti, and North K... ...will not know the full effect of his presidency on North Korea until well after he is out of the White House. Until then, we will have to keep on making intelligent guesses as to where his policy will bring us in the future. Works Cited Dao, James. "Bush Administration Halts Payments to Send Oil to North Korea." New York Times 14 November 2002. Online ed. Hastedt, Glenn P. American Foreign Policy Past Present and Future, 5th ed. Prentice Hall: Upper Saddle River, NJ, 2003. Henirksen, Thomas H. "Clinton's Foreign Policy in Somalia, Bosnia, Haiti, and North Korea." Stanford: Stanford University, 1996. Sanger, Daved E. "North Korea Says it has Program on Nuclear Arms." New York Times 17 October 2002, Online ed. Shenon, Philip. "White House Rejects North Korean Offer for Talks." New York Times 4 October 2002, Online ed.

Rodriguez and Mexico :: essays research papers

Rodriguez characterizes Mexico as a country with a culture of tragedy and America as a country with a culture of comedy. However, America is comedic in the Greek sense-in the sense that America is not comedic at all. Rodriguez feels that Mexico, in being the place of tragedy, is better off. America, on the other hand, has to face the burden of optimism, and the subsequent let-downs. Thus, in a sense, he characterizes them in ways that oppose what he truly thinks of them.   Ã‚  Ã‚  Ã‚  Ã‚  Mexico is described as tragic-those who are of Mexican descent are often very traditional in thought. Rodriguez’s father held the traditional beliefs that old men are wise, that life is disheartening, and near one’s death is the point where one must look back on their life. However, he also feels that Mexico is a happier place, with sweeter children and more lavish funerals. Perhaps he views Mexico as the tragic place because it represents a lost heritage to him. He, who in his middle age, finds himself agreeing with the Mexican ideals, nevertheless finds himself affected by living in America. Instead of being raised with the ideas of Mexican culture, he was raised with Protestant optimism characteristic of California. He was forced to abandon the way of life of his ancestors, even if only partially. America-more specifically, California, conquered the Mexican ways, and in so doing, lost the opportunity to reconcile the Catholic South and the Protest ant North. Thus, Mexico emerged as the tragic hero and California as the laughing victor. California is comedic because it is a place where it is possible to start anew, to defy the traditional.   Ã‚  Ã‚  Ã‚  Ã‚  Rodriguez views California as a reconciliation between comedy and tragedy. It is both the place where many Mexicans immigrated to and the place where Americans move to escape the constraints of society. Mexicans hoped to experience the comedy of California-where it is possible to change your sex, divorce, and become famous. Even Rodriguez’s parents moved to California, and live in a house with many telephones and televisions.

Tuesday, September 17, 2019

Asses the Significance of the Treaty of Versailles

The Treaty of Versailles did not dismantle Germany from its ability to wage war; it neither made the people grateful towards the allies. As the Italian political philosopher Niccolo Machiavelli of the 1500’s stated â€Å"___________†. The Treaty imposed many demands of the war weary country, these demands did not have an immediate effect on the country, and it instead gave a long-term legacy of bitterness and humiliation. The defeat of the German military was a shock to most Germans, as they were made to believe that they would be the victors in the â€Å"Great War†. The Treaty came as an equal shock, as it gave the government no chance to negotiate the terms. The terms included military provisions to be changed, territories to be given away and reparations to be paid. The military of Germany was to be reduced to 100,000 and Germany was not allowed to produce any guns, poisonous gas or tanks. These terms affected many Germans especially wealthy industrialists who made large profits from the business. Those thousands employed into factories to build weapons also lost their jobs. The German military was at a time four million strong before the war with the reduced military this put thousands of trained men onto the streets without employment, these men would prove later to be enemies of the new republic. The German General Staff was dismantled, therefore putting influential generals such as Ludendorff and Hindenburg unemployed but most importantly there loyalty was to nobody since the Kaiser abdicated. This allowed ambitious politicians to take advantage of the famed generals as they persuaded them to join their political parties. An example of this is Hitler having Ludendorff join him in his 1924 failed Munich Beerhall Putsch, he was used as a symbolic figure supporting Hitler’s regime. The powerful navy that German had, was to be reduced to a mere few ships, and the U-boats were strictly forbidden. This had the same affect as it did with the army; it put hundreds of sailors on the streets unemployed and angry. Since it was not the Military that decided to sign the armistice they felt a sense of betrayal from the new government. This was to be called the â€Å"Stab in the back† theory, which was used by the military to explain why they were defeated and recalled. This theory was made to preserve the unscathed honor of the German military. The territories that the Treaty demanded were immense. The long held provinces of Alsace and Lorraine were taken by France. These provinces had been held by Germany since 1871, the people were a generation of Germans and the immediate change came as a shock. The Allies also claimed economic control over the rich coal-producing area of the Saar basin, its workers were German but the production was to go to France. This had a dramatic effect on the amount of coal German was producing, before the war Germany war producing 277 million tonnes and 14 million tonnes of steel. Because of the economic control of the Saar basin both of these vast industries were badly disabled, this therefore effected Germany producing an effective income from these industries that it prospered. The large region of Posen was created into a new country called Poland, but the allies determined that the new nation needed access to the sea. Therefore part of West Prussia was given to Poland, this area was called the Polish Corridor where many Germans lived, now under the new country Poland. The large city of Danzig was also taken from Germany and taken by the control of the new-formed League of Nations. Schleswig a region farthest north of Germany and south of Denmark was to be given to the government of Denmark, as the regions of Eupen and Malemdy was given to Belgium. The large area of the Rhine land, which lied on the border of Belgium and France, was to be demilitarized effectively stopping any further motivations to invade France. Germany had ten colonies based in Africa and Asia; these colonies had an overall population of fifteen million, adding trade and tax income to Germany’s government. But the Allies stated in the Treaty that Germany was â€Å"Colonially Unworthy† and as a result lost control of all her colonies. These colonies were controlled and administrated by the League of Nations. All these territorial demands from the Treaty of Versailles not only had an economic impact to the German country but it had a morale effect of humiliation to the German populace. Many articles in German Newspapers such as the Deutsche Zeitung stated, â€Å"German honor is being carried into its grave†¦. The German people will with unceasing labor press forward to reconquer the place among nations to which it is entitled. † and as well politicians used this as propaganda promising that their party will reclaim German honor. The Treaty also forced Germany to take full responsibility of the war. The Allies made them accept that it was their fault and that the countries all suffered because of Germanys selfishness. Because they were blamed for the war the Allies saw fit that they were to pay for the reparations of the war. This amount concluded to 32 billion American dollars, this was but a mere partial cost to the war but Germany still tried to resist paying the total amount. The reparations were not paid until 1921 a full three years after the signing of the Treaty. The initial German reaction the terms of the treaty was shock and anger. Since the Kaiser abdicated it fell upon the new government to sign the treaty, because of this the Weimar Republic was always held accountable for disgracing Germany. There were many in Germany, who urged a rejection of the treaty like Hindenburg, but many more had a realistic perspective and insisted that the government sign it; these people were General Groener and other members of the Reichstag. The initial anger and outbursts the treaty invoked on the people was of hopelessness, the reality was that Germany had little choice other than to accept the treaty. If the Government did not sign the Treaty the country would have been dismantled like it was after World War 2. The Treaty of Versailles importance is clearly exemplified in its determined effect of Germany. The country lost about thirteen percent of its territory, 12 percent of its population and a combined 64 percent of its iron and coal industries. But Germany still remained one of the strongest countries on the continent. As the Treaty effected the country on an emotionally level, the Germans of all classes were disgraced and angry at the Weimar Republic for signing the treaty. The Treaty obviously did not destroy Germanys ability to create an army (WW2) nor did it encourage them to not go to war. The effect of the Treaty forced a generation of Germans to swear vengeance on the Allies.

Monday, September 16, 2019

Macbeth Explication: “If it were done when ’tis done” Essay

The final scene of the first act opens up with a powerful soliloquy presented by Macbeth, If it were done when tis done (I.7.1-28). Shakespeare uses various literary techniques to express the ideas rushing through Macbeths mind prior to the murder of Duncan in his home. In previous scenes, Macbeth has been told prophecies of his future predicting him as king of Scotland, Duncans current position. Macbeth, with the aid of his wife, sees this task accomplishable only by the murder of the current king. This soliloquy presents itself at a crucial point of decision, only hours before the opportune minute of attack The soliloquy opens with Macbeths ideas on how he would hope the murder to be. If it were done when ’tis done, then ’twere well / It were done quickly (I.7.1-2). These two lines show how indecisive Macbeth is about committing the crime. He is saying that if the murder be done, it should be done fast. The if shows that Macbeth is unsure that he wants to follow through with the initial plan. Shakespeare also shows that Macbeth wishes to get it over and done with, showing haste and not thinking it out properly. If the assassination / Could trammel up the consequence, and catch / With his surcease success; that but this blow / Might be the be-all and the end-all here, / But here, upon this bank and shoal of time, / We’d jump the life to come. (I.7.2-7). Here, Shakespeare uses a metaphor to compare the murder as something that could be caught and once caught; it would not yield any consequences. He then goes on to say that in the real-world, this cannot be true. Shakespeare craft fully shows that Macbeth knows that their will be consequences to the murder and that thinking that everything will be okay is not a logical thought. Macbeth continues, But in these cases / We still have judgment here, that we but teach / Bloody instructions, which, being taught, return / To plague th’ inventor: this even-handed justice / Commends the ingredients of our poisoned chalice / To our own lips. (I.7.7-12). Macbeth states that he still has the choice whether to commit the murder or not to. Shakespeare uses a metaphor to compare the murder with bloody instructions being taught. Macbeth also says that the person who commits the murder (or teaches the bloody instructions), come back to the murderer (or inventor). By saying  this, Shakespeare throws in the element of Macbeth foreshadowing his own demise. He then goes on to compare the return of the misdeeds through the imagery of a poisoned cup. He speaks of how the poisoned chalice, although used on others, will once again come around to his own lips. Macbeth begins to give and weigh reasons for and against Duncans murder. He’s here in double trust: / First, as I am his kinsman and his subject, / Strong both against the deed; (I.7.12-14). Macbeth states that Duncan trusts him in two ways, first of which as his loyal solider. Macbeth then explains how he is expected to be loyal to his king and protect him; not the contrary. In these lines, Shakespeare includes the irony that Macbeth plans on doing what he is supposed to prevent. Macbeth continues, then, as his host, / Who should against his murderer shut the door, / Not bear the knife myself. (I.7.14-16). Here, Macbeth states that he is, secondly, Duncans host. Therefore, Macbeth should be protecting Duncan against a murderer, rather than killing Duncan himself. Shakespeare uses the same irony as in the preceding lines. Macbeth continues with reasons against the murder. Besides, this Duncan / Hath borne his faculties so meek, hath been / So clear in his great office (I.7.16-18). Here Macbeth states that Duncan has always been good to him and never abused his power. Macbeth now switches over to the topic of what will happen if Duncan is murdered. that his virtues / Will plead like angels, trumpet-tongued, against / The deep damnation of his taking-off (I.7.18-20). Shakespeare uses personification and a simile to compare what will happen to Duncans virtues after the murder. He describes Duncans virtues as angels, who with spread the news of his murder to all. He proceeds, And pity, like a naked newborn babe, / Striding the blast, or heaven’s cherubim, horsed / Upon the sightless couriers of the air, / Shall blow the horrid deed in every eye, (I.7.21-24). Shakespeare again uses a simile to compare the pity of the people over Duncans death to a newborn  baby. Shakespeare then uses imagery to convey a picture of how fast and gracefully the news will spread; a baby, a common representation of innocence, whisking through the air, telling everyone about the deed that took place. In the succeeding line, Macbeth predicts, That tears shall drown the wind. (I.7.25). Here, Shakespeare uses vivid imagery to describe the mood of the people after the death. People will be distraught over this occurrence and will weep as rain falls from the sky. In the conclusive lines of the soliloquy, Macbeth poses the sole reason he has for the murder, I have no spur / To prick the sides of my intent, but only / Vaulting ambition, which o’erleaps itself / And falls on th’ other. (I.7.25-28). Macbeth here says that he has absolutely no reason to kill Duncan, save for his ambition. In his final sentence, Shakespeare then personifies his ambition as overleaping which falls over itself. Macbeths ambition overleaping and falling also foreshadows Macbeths death. After the soliloquy, Macbeth changes his mind and no longer wishes to kill Duncan. But with the persuasion of his wife, changes his stance again and goes through with the murder. All of the events, the spreading of the news of the murder, the consequences of the assassination, people hysteria and Macbeths own downfall, which Macbeth foreshadowed in his soliloquy, do prove accurate.

Sunday, September 15, 2019

R.M.’s symptoms Essay

1. Compare her VS with those of a healthy person at her same age. R.M.’s temperature is low: 96.8 F and normal range is 97.8 -99 F R.M.’s blood pressure is elevated: 142/84 and normal range is 120/80 R.M.’s heart rate is low: 52 and normal range is 60-100 R.M.’s respiratory rate is on the low end of normal: 12 and normal range is 12-25. 2. List eight general questions you might ask R.M. to assist in determining what is going on with her. Does your family history of thyroid, adrenal, or pituitary disease? Have your menstrual periods been altered? What have your sleep patterns been like? Have you been exceptionally nervous? How has your appetite been over the past 6 months Have you had weight fluctuation over the past 6 months Is there a history of diabetes in your family? Have you had any radiation therapy to your head and or neck? 3. You know that potential causes for some of R.M.’s symptoms include depression, hypothyroidism, anemia, cardiac disease, fluid and electrolyte imbalance, and allergies. As part of your screening procedures, describe how you would begin to investigate which of these conditions probably do not account for R.M.’s symptoms. As part of screening procedure, e began our investigation by focusing on auscultation of the heart and lung sounds for sign and symptoms of cardiac disease or problem. However, there are no abnormalities present with R.M.’s heart. According to R.M.’s symptoms, it is clear that she does not have any signs of cardiac disease, symptoms of allergies, and fluid and electrolyte imbalance. R.M. has symptoms of hypothyroidism, anemia, and depression. 4. Unnecessary diagnostic tests are expensive. What tests do you think would  be the most appropriate for R.M., and why? We think that thyroxine, (T4), and pituitary thyroid-stimulating hormone (TSH) will be appropriate for R.M. because this test will confirm the diagnosis of thyroid failure. Cholesterol levels need to be checked and also other blood tests needs to be performed to detect levels of calcitonin, calcium, prolactin, and thyroglobulin and check for anemia and liver function. All these tests can be affected by hypothyroidism. 5. Interpret R.M.’S laboratory results. 6. The family practitioner affirms a diagnostic of hypothyroidism. With this diagnosis, what other signs and symptoms would you want to investigate? Other signs and symptoms we would want to investigate include impaired memory, depression, elevated blood cholesterol level, irregular menstrual periods, and stiffness or swelling in the joints (Mayo, 2014). http://www.mayoclinic.org/diseases-conditions/hypothyroidism/basics/symptoms/con-20021179 7. The family practitioner prescribes levothyroxine (Synthroid) 1.7 mcg/Kg body weigh/day. At this time. R.M. weighs 130 pounds. What should be her daily dose of Levothyroxine in milligrams? How would her prescription read?