An Explanation of the Causes and Effects of the Enron Accounting Scandals

From the 1980s until now, there have been a lot of accounting scandals which were widely announced on by media. The result of this situation is many companies were bankruptcy protection requests, and closing. One of the most widely reported emulation of accounting scandals is Enron Company. Enron Corporation is one of the largest energy companies in the world. Enron was founded in Houston, Texas, America in July 1985 by the consolidation between Houston Natural Gas and InterNorth of Omaha, Nebraska (â€Å"Enron and Enderson: The story†, n. d. ). According to Sridhanran, Dickes & Caines (2002, p. ), Enron’s rank number is the seventh in the United States by Fortune magazine in April 2002.Their businesses were sale of nature gas, electricity sector, water, metal, broadband and newsprint. Enron has been altered from the old economy company to the new economy company and focus on HFV (Hypothetical Future value). The profits were grown by buying electric at stable prices fro m the suppliers and sale the different prices for customers. When the falsehood of their profits was opened, the investors withdraw the capital. Enron start collapse (â€Å"Case study: The collapse†, n. . , pp. 1-2). Definitions Accounting scandals are political and business scandals using illegal accounting systems and fraud in the financial statements. According to Hanson (2002, p. 1), Enron accounting scandal is the most important common failure in the banks during the 1980s in the United States. This leads to changing in business and the law. When Enron was bankrupt, the economy of America was dropped, and many employees were lost their jobs. Outline and Limitations The assignment will explain two main reasons and two effects of Enron accounting scandal.The assignment will conclude with review the Enron accounting scandal and giving the lessons for another company. The Causes of Enron Accounting Scandal Business Fraud A business fraud is one of the most important reasons which made bankruptcy of Enron. Firstly, limited partnership companies were opened by CFO Andy Fastow. He used many partnership companies such as J. P. Mogan Chase and Merill Lynch to hide their enormous debts and losses from investors. They borrowed the great amounts of money from financial institutions to buy many assets; this led to wrong view about Enron condition.It helped the stock price increase (â€Å"Enron accounting scandal†, 2009). In addition, the financial strategy, the business consultants and the accounting techniques are wrong choice of Enron. They used established investment money to build securitization abilities. According to Buondonno, David, Pufky and Rollings (n. d. , pp. 11-12), Enron has distorted the financial statements using the complex methods. They used fake companies (SPEs) to move money between different banks and created false financial statements. This led to misunderstanding of shareholders about the real financial statements.Moreover, Enron predicted the future market of energy price. As a result, the sale prices of Enron known as mark-to-market, which control the energy trading business and the reports which they want to show. Furthermore, Enron used wrong accounting system. They used mark-to-marked trading which is greatly hard to change to another system. The reports were shown losses or gains on the stock and security price at the end of the year. Enron was able to use SPE (special purpose entities) to trade in legal time or illegal time so that income could change to correct with investor expectances.Lastly, Enron had a huge negative dollar cash flow from bank loans. They needed to pay around two million dollars per day by cash. A Corruption and a Lack of Accounting Techniques According to Buondonno, David, Pufky and Rollings (n. d. , pp. 18-20), Management level and accounting level were forgotten in Enron situation. Endrew Fastow, the Chief Financial Officer (CFO) of Enron used his power to corrupt by using his knowledge into the agreements and making the bonuses from the agreements. Endrew and his wife got benefits from Enron to buy Chewco where his wife is owner.He controlled subsidiary companies to buy stock and hid debt for Enron. Enron did not follow the accounting rules. Every mistake in accounting needs to note and describes for shareholders know, and writes on the financial statements. In 2001, Accountants cannot combine Chewco into the Enron’s financial statement. This lead to misunderstanding report which show the financial statement of Enron such as a decrease Enron income and an increase Enron’s reported debt. In addition, Enron tried to make maximize profits by break the law.Therefore, dishonesty in the financial statement, corruption and a lack of knowledge and skills of accountants are the causes of the Enron’s bankruptcy. The Effects of Enron Accounting Scandal on Employees and shareholders When Enron was bankrupt, the most affected people are Enronâ₠¬â„¢s workers and shareholders. Many people lost their jobs, their whole pension and all of the shareholders lost their money (Dunder,n. d. ). According to Raver (2006, p4-5), Enron stocks prices were increased nearly double in one year by many ways such as legal and illegal way.The stock price was increasing so fast, many Enron employees bought Enron stock as saving money, and also their pension are in Enron’s stock too. When Enron was failing, Enron’s stock price was decreasing until no longer value, many Enron workers lost all their money, their jobs and also their pension lost too. For this reason, they almost have nothing; they only have social security funds. The suddenly decrease of the value in Enron stocks influenced the retreat savings of thousands Americans who are not Enron employees. Many Americans saved their money in the index funds.Enron’s stock was formed by the different sources of investment, such as the state pension plans, university and oth er non-profit foundations (Sridharan, Dickes & Caines, 2002, p. 4). Therefore, when Enron scandal was happened, this entailed many effects on workers, shareholders and Americans who are not Enron employees. They lost their money, their jobs and their future. The United States and the Stock Market Enron accounting scandal helped American improve their knowledge of business and accounting. This leads to changing in the U. S. aw to protect people from the business fraud (Raver, n. d. , p. 4). They fortified retirement security of American, and limited on selling stocks for employees (Sridharan, Dickes & Caines, 2002, p. 8). Moreover, the stock market was affects by the Enron accounting scandal, Enron’s stock was $80 per share. When the Enron accounting scandal was discovered, the price of Enron’s stock fell down less than $1 (â€Å"Enron stock prices†, n. d. ). Conclusion The Enron accounting scandal is one of the biggest problems of cheating in accounting in Ameri ca.It changed the most American life, and people behold themselves to know the answers of cupidity and break the law in business. The Enron accounting scandal has many reasons such as business cheating, the corrupt of the power person and inexperience of accountants. For this reasons, Enron bankruptcy had many effects on Americans social such as workers, shareholders, the American economy and the law. The lesson from Enron accounting scandal were found by many ways such as the conflict of interest between two roles played, employees’ protection, changing in business managements, and ethics in business, cautious investment.

Ethical Issues in Managing Employee Behavior

Ethical issues for dealing with individual employees is difficult because managers on the front line are responsible for various accounts such as hiring and firing disciplining and performance evaluation also during all these procedures managers are responsible for employee supervision because managers are role models for their employees in their department it is critical the managers are able to ethically resolve problems within the organization but unfortunately it is not always the case. Employee behavioral problems that occur in the workplace can have a dramatic effect on the overall atmosphere.It is the manager’s responsibility to correct these problems in a morally right way. Doing so disrespectfully or unethically can result in even more problems and a decrease in productivity within the organization. The concept of ethics is a key practice that many organizations need to obey by. Managers and supervisors must develop strong ethical standards that are to be taken into c onsideration when employees are disrupting the workplace. What are ethics and business ethics? Ethics is defined as a code of morals practiced by a person or group of people.Ethics in business the study of what divides the right and wrong or the good or bad behavior in the workplace environment. An Organization has a group of people that work together to achieve a common purpose. The moral challenges that these men and women face each day along with a whole range of problems that could occur, are why ethics plays such an important role in business. Most large businesses have a written code of ethics, sometimes called a code of conduct to set the standards that employees are to follow.Many ethical decisions are based on morality, society’s accepted standards of behavior. Unfortunately it is not always clear cut what decisions are ethical and which are not, In many cases the law is used to determine the direction of our behavior, however the law is not always the best tool to u se because some things may be legal but not right. Ethics are what you stand for, not just about what is legal. Unethical Practices by employees can arise in three ways; The first are individual factors, because people bring to their jobs, tier own ideas of what is morally right and wrong.The second is organizational factors the scary thing about unethical behavior at work is that it is not necessarily driven by personal interests, sometimes ethical lapses occur because employees feel pressured to do what they think is best to help their company. Third is Management influence, the manager sets the tone and by his or her actions sends signals about what is appropriate behavior for example if the boss is seen taking a longer lunch break, you may not follow the directed time and take a longer lunch breakThere are three main reasons on why employees act unethically and it is becoming a rapidly increasing problem in organizations some of the more problematic and reoccurring issues are, E mployee theft, showing up late, disclosure of confidential information, on the job drug and alcohol abuse, false documents, employee discrimination and bullying, misuse of company funds, improper hygiene and a rapidly growing concern is using email and social media and cell phones for personal on work hours the only way to effectively make sure these issues are diminished or improved is for the manager to handle the situation ethically, but it is not a perfect world and people even managers can bend the rules.One of the first problems are automatic dismissal when it is not needed. Manager must have proof the employee has had been performing unethically, instead of setting up a meeting with written documentation and a third party to hear the conversation . Managers also know that if it is their word against the employees that there are good chances ofthem not even being questioned. Similar personality traits lead to managers that are power hungry and are too assertive when engaging w ith the employee, almost to the point where it is bullying. Even tho assertiveness is good and generates results it must not be aggressive. Managers who take pleasure in fear will use this tactic rather than understanding the issue.Managers who are considered bullies, have little interest in change and is the company likes the results that manager is providing they may have even less interest on how they are behaving. Managers will also bully to avoid accepting responsibility for their behavior and why it may have assisted in the employees unethical decision making and to divert attention away from their inadequacy . The same can be said for harassment the â€Å"fear† approach to fix things. Instead of dealing with the situation head on, they constantly call or think that checking over your shoulder will resolve employee behavior, and it may produce results but does that make it right, no. With the ever growing use of cellphones in the workplace managers may take advantage of the fact they can contact you at any given time.What can happen in a lot of cases is the harassing manager will scold any employee suffering from stress and see it as a weak and excuse for their poor performance for example constantly saying â€Å"get back to work† and always being on ones back. On the other side of the spectrum of dealing with employee behavior that is not accepted is managers can be passive, some managers have a difficult time disciplining employees for a number of reasons. They may feel insecure or akward about approaching employees.Some managers rather keep an employee who is producing results and and not behaving, then have to report them or even fire them and train another weather it is that they do not want their management skills questioned, or the cost and time and energy it takes to train. In some occasions managers believe the problem will resolve itself  or they may not have the assertive personality to discipline other adults. Ignoring conflic ts may also be because some especially new managers can find themselves at loss the first time a conflict arises and it doesn’t just sort itself out and have difficulty finding the right language and the right techniques to use at the time. Also managers who have tried to solve a problem and failed could Lose hope and a willingness to commit to problem solving are common responses when a manager feels that his efforts are all for nothing. If previous attempts at resolution haven’t gone well, they may feel others may have lost trust in their abilities. â€Å"I don’t know where to start.†Taking the time to assess a situation and make a plan burns up energy and attention. It’s smart to sit back and consider your next steps instead of jumping into a conflict willy-nilly, but inaction doesn’t get you any closer to resolution. Develop a plan with clear goals in mind, and get whatever help you need to put it into action. A common issue is the †Å"I have real work to do† approach. Addressing personnel issues is an important part of being an effective manager but in some organizations managers feel it is better dealt with by human resources, the same could be said it there is an accounting issue that the document is sent straight to the Accounting department.Although human resources managers are for recruiting, hiring and problem solving it is as equally important for the manager to be involved, you cannot manage properly if you are not fully aware or separate from what is going on in the organization, another issue is that managers will put blame on HR when the problem is not solved. Managers make mistakes while evaluating employees and their performance because of biases and judgment errors of various kinds spoil the process. When there is a behavioral issue managers will automatically assume that is not committed by â€Å"all-star† employees and spend so much time on the average joe in the organization the pr oblem is never solved or may even worsen , new issues and jealousies may arise if the employees feel pin pointed on. This would be an example of horn and halo effect.Personal Biases are very serious he way a supervisor feels about each of the individuals working under him – whether he likes or dislikes them – as a tremendous effect on how the employees are handled personal Bias can stem from various sources as a result of information obtained from colleagues, considerations of faith and thinking, social and family background and so on. They could be based on: Race and ethniticy which refers to broad division of people based on their biological characteristics such as colour of skin, colour of hair and their facial features. These differences developed among humans in prehistoric times due to different groups of people developing in different parts of the world isolated from each other. Ethniticy, Ethnicity refers to the common characteristics of a group of people that distinguish them from most other people of the same society. Ethnicity is based on commonality of ancestry, culture, language, nationality, or religion, or a combination of these things.Gender and sexuality – gender bias is unequal treatment in employment opportunity (such as promotion, pay, benefits and privileges and resolution tactics, and expectations due to attitudes based on the sex of an employee or group of employees. As times develop sexual orientation is becoming more accepted but there are still judgements and labels placed. Managers may lie to employees who are not meeting up to standards Or, give out false deadlines. Nothing drastic, perhaps a day or two earlier than normal, just as long as they still has a reasonable amount of time to complete the task, but also enough time to handle anything that may pop up unexpectedly.Many employees will often say that rewards or bonuses were promised and never given, this happens a lot in major organizations when higher posi tions know that employees need this job and take advantage of that fact they are very confident that if these promises are not met the employee will not complain or quit. When issues arises managers may unevenly distribute the workload to employees that they know will get the task done and give the â€Å"slacker† less responsibility without notice or increase in pay. This quick fix is unfair and will only be a temporary fix. In most cases the employee with the increased workload will find themselves pressed for time and other responsibilities will be put on the back burner and could be completed incorrectly or rushed. That same employee may develop stress which can lead to absences, spoiled work environment, less production in work, stress leaves or at the last case the employee may quit.To ensure proper decision making, it is important to follow these basic steps ; step 1: Evaluate all the facts in the situation closely, it is very easy to distort information to benefit ones elf, getting outside input can help you see things that may have been overlooked . It is also very important to see the situation based on your values and the values of the people involved. Step 2: To make a fair prediction based on the facts gathered the reasoning for this is increasing your chances for better results. Step 3: Identify your feelings (or your inner conscience) to make sure you are rationalizing the situation properly Step 4: Ask yourself if you can live with the decision you are about to make ask questions like; – Would I be willing to tell others what I had done?– Would I feel worse or better about myself? – Would I feel proud about my decision making and would expect others to do the same under similar circumstances? – And would you want everyone to act the way you did Step 5: Would you be able to have evidence to justify your decision if questioned

ANALYSIS AND COMPANY PROFILE of Hewlett Packard

ANALYSIS AND COMPANY PROFILE of Hewlett Packard On 1 January 1939, there are Stanford University graduates which are Bill Hewlett and Dave Packard, they formed their partnership and decided to start a business. They decide the company’s name with a coin toss. They made a historic commitment to innovation when they founded HP in a garage. The first product they created was an audio oscillator used by Walt Disney to make Fantasia. For over 70 years since then, HP has continued innovating and helping people, businesses, and communities worldwide use technology to improve their businesses and lives. In 1957, the company goes to public. In keeping with Bill Hewlett and Dave Packard’s respect for workers, HP takes the then-unusual step of giving stock grants to employees. The growing company begins building on the site that will become its corporate headquarters in Palo Alto, California. HP also embarks on a path toward globalization, establishing manufacturing and marketing operations in Europe. In the 1980s, HP becomes a major player in the computer with a full range of computers, from desktop machines to portables to powerful minicomputers. HP also links computers with its electronic instruments and medical and analytical products, making them faster and more powerful. HP makes its entry into the printer market with the launch of inkjet printers and laser printers that connect to personal computers. HP’s high-quality, inexpensive inkjet printers spell the end of dot-matrix printers. In 1984, HP debuts the LaserJet printer line, goes on to become the company’s most successful single product line ever. The quality and reliability of HP’s printers make HP a highly recognizable brand by both consumers and businesses. HP focuses on simplifying technology experiences for all of its customers, from individual consumers to the largest businesses at the beginning of the 21st century. HP grows to become the world’s largest technology company with a portfolio that spans printing, personal computing, software, services and IT infrastructure. Later in the decade, a steady stream of acquisitions increases HP’s influence in the software, personal computing and printing markets, and in 2007, HP achieves $100 billion in revenue. In 2009, after the acquisition of EDS, HP moves up to No. 9 on the Fortune 500 list. GENERAL PEST The PEST analysis is the macro-environment or defined as external environment in business point of view. It has been affirmed to be important strategic tools to assess the market growth or decline and it is also a business measurement tool to analyze the external impact of the strategic development of a business. The factors of the PEST are Political, economic, social and technological. These elements are likely to impact your future business. It is drag in an organization considering of the external environment before the project is began. PEST analysis is very simple to complete, is a good material for the workshop session and it is also an effective brainstorming session. Political environment, including a country’s social system, the nature of the ruling party, the Government’s guidelines, policies, laws and so on. Different countries have different social nature, different social system of the organization have different restrictions on activities and requirements. Even if the social system is constant of the country, due to distinct of the ruling party, the government policy features and influence of policy orientation of the Organization is changing at different stages. There are several important political and legal variables which are the nature of ruling party, political system, economic system, tax policy, trade and tariff controls, social and employment legislation.

Assigned topic Research Paper Example | Topics and Well Written Essays - 1750 words

Assigned topic - Research Paper Example In Socrates discussion with Thrasymachus that followed, he first cleared that it was compulsory for people to abide by rulers and just like other people were prone to make mistakes in formulation of these laws. So the times when rules have made a mistake and people are claiming it as justice than it won’t be interest of stronger. In that case when people claim justice abiding by the rule of state or the ruler it won’t be for the interest of stronger but would actually cause injury to those in power. This might be unintentional but clearly states that Thrasymachus claim of justice only being interest of stronger is not always abided by. This is what they agreed upon at the end of discussion. Book 2 According to Glaucon, what do people praise instead of justice? Why? The best way to living by Glaucon is when men have done and suffered injustice and they come to a mutual ground which would be called as lawful and just in the society. Ring of Gyges is explained by Glaucon a nd is termed as a mythical magical artifact. This has this divine and strange power that makes its owner invisible. He says that every man believes in his heart that doing injustice would give more benefits that acting by laws of justice. If someone gets the ring of Gyges and doesn’t use it as mean of injustice he would be termed foolish by others. This is the reason people praise injustice because they believe that it will give them more benefits. Paper 2 Politics is a broad term which includes Strategy, economics, and rhetoric and since it includes all of the other sciences, it is called the master of art. It involves people who in a certain way control lives of people as they make legislations which make things happen and tell people as what they ought to do or what they should stop doing. This is what brings man to a good end. A young man is full of action and passion and his interest are mostly on the basis of action rather than knowledge. Moreover, his experience in lif e would be in general rather than specific to this political science and he would be good with life in general terms but not specifically with political science. Happiness can’t be identified with honor since that would end of man’s political life. For a man, honor is basically assurance of his goodness and men with practical wisdom are the ones who seek honor. Virtue however is related with inactivity according to Aristotle and no one would call such a person as happy and hence honor is not related to happiness. Happiness according to him comes with all noble acts and it is impossible to do Noble acts without proper equipment and therefore it is important to have external goods to create happiness. Virtues are intellectual as well as moral. Intellectual wisdom includes philosophic wisdom, understanding and practical wisdom would be included in intellectual wisdom whereas liberality and temperance are said to be part of moral virtue. Moral Virtue is a mean between two vices and lies between excess and defect and also a mean between passion and action. This would simply mean choosing the in between pathway. Paper 3 Prodigality and meanness are two words that Aristotle explained on the basis of wealth. Meanness according to him is the excessive desire and lust for wealth than there should be in a normal person. However, Prodigality is a complex termed described by him. These are those men who spend money on self-indulgence and they are basically

MANAGING DECISIONS Essay Example | Topics and Well Written Essays - 3000 words

MANAGING DECISIONS - Essay Example It is with this, that they came up with goals in which they strive to achieve. Tap helps to introduce children to the rhythm and music; it was first introduced in African American dance and named, Juba or Irish Step-Dancing and thought to have taken roots since 1800 when minstrel shows were taking course. Later in 2008, it was started by Rachael when she relocated to Greenwich from Islington after taking a career as a professional dancer. Her aim was to establish the benefits to creative and independent children. The school attracts customers by offering the first free lesson for starters, this works as an encouragement where those who really have the urge to cut down calories voluntarily get encouraged and start the exercises as soon as they get time. Povaly (2007), stated that for old members, the organization charges four weekly, where each day, people pay different rates like, they begin their classes with Tots Tap among the three year olds, where children are first taught how to count music and hold a beat, after gaining this skills, they are then taken to the next step of pre-primary tap. By this time the organization targets the school going child. With goals at hand and support from her clients, Rachael has transformed and brought in new styles of teaching which have integrated dance, music and methods that build on her past experience when she was working with major bodies of dancing in the United States. She has also worked to incorporate her styles with that of the British Ballet Organization, so as to make sure as the groups develop; they are able to work in accredited recognition of their development. The mentioned factor of the growing market is due to the merits the organization is striving to give its clients. An example is where, for starters, they are allowed free services for that day, and then the subsequent days of the week, they are charged at

The Sociological Imagination Coursework Example | Topics and Well Written Essays - 250 words

The Sociological Imagination - Coursework Example The wealthy can afford any service a feature that makes them feel invincible. They overburden the health care system thereby denying the poor the vital services. A functionalist would define the obesity as a major social problem that arises from failures in various social institutions. Obesity is a lifestyle disease that with the rising number of obese people in the United States showing the intensity of the failure of various systems that would otherwise safeguard the health and physical fitness of people (Pollock, 2013). A symbolic interaction theorist, on the other hand, would define obesity as a social problem that arises from the interaction among people in the society and their ability to share values. To these theorists, obesity arises from changing lifestyles and the spread of obesity represents the efficiency and intensity with which people share the changing values. Functional theorists provide a realistic approach to the problem since they investigate social features and institutions that have failed thereby leading to the problem. The theory addresses obesity as a social problem that has effective solutions by addressing the changing lifestyles and nutrition two of the most significant factors that contribute to the spread of the problem (Bartos & Wehr,

Psychological Case Study Essay Example | Topics and Well Written Essays - 2000 words

Psychological Case Study - Essay Example Prior to the age of 13, her parents describe her as "well-behaved and doing well in school". Up to that time, she had no problems academically or behaviorally in school. The trouble began when Client S began eighth grade. At that time, her behavior began to change. Client S was born in Australia and her parents both work. It is not clear why the parents stated that she was born in Australia. Her mother works as a receptionist and her father is a supervisor for an electrical whole sale firm. It appears from what they have stated that they have traditional values and want her to abide by their rules. The client does not seem to think that these rules are necessary since she is now 15. Presenting Problems/Symptoms During the counseling session, the client presents as very positive and confident. She is dressed very clean. During the counseling session, she talks about her parents and feels that they are being too strict with her. She states that she hates doing chores and homework. She has been doing many things to show signs of rebellion: she snuck out of the house and stayed out late, complains about her parents to let her go out and hang with her friends. She states that her friends always get to do things that she does not. Evidence Based Theories and Models Client S does not seem to be exhibiting behavior that is inconsistent with being a teenager. In looking at theories and models, it was important to describe developmental theories and models that work well with teens. Although Sigmund Freud had many things to say about adolescence, it was Erik Erikson who took Freud's theories and advanced them. In Erikson's theory, Client S represent's Erikson's fourth developmental stage which is ego identity vs. role confusion. In this stage, the peer group is more important than family and the peer group acts as role models. During the time between ages 12 and 18, Client S will be struggling to be herself and to identify what that means to her. The psychosocial values that she will possess will be fidelity and loyalty (Boeree, 2006). In applying Erikson's theory to Client S, it becomes clearer that she is in the phase of wanting to be with her friends and they are making up a large part of her life. The challenge can be that the friends she has chosen may not be the best friends for her and they may be influencing her behavior. This would be something to explore in sessions. Piaget took a more cognitive approach in his developmental stages saying that children are able to reason in the abstract after the age of 12. Adolescents may become more self conscious about their appearance and that they are always being criticized for who they are at any given moment (Resource Center for Adolescent Pregnancy Prevention, 2009). Physical development is very important at this age as well. The hormones in the body are changing and the adolescent can be going through physical and emotional changes. The child is moving from being a child to maturing into adultho od. Although this happens differently for different children, all children go through this change at some time. In addition to the physical maturing of growing breasts and hair under the arms and in the pubic area, teens also experience their first menstrual periods and they begin to worry about their bodies. Emotionally, the teen may be experiencing mood swings, or pushing away from the parents in an attempt to create their own identity (U.S. National Library of Medicine, 2011). All of these changes are

Living Conditions During the life and times of William Shakespeare's Research Paper

Living Conditions During the life and times of William Shakespeare's era - Research Paper Example An author (playwright) sees reflection of one’s own experiences and surroundings while creating the characters. One cannot sweep it under the carpet and why should one? Authenticity about a character comes out of direct experience plus fertile imagination. This quote of Shakespeare is perfectly applicable to him. In Twelfth Night he writes, â€Å"Be not afraid of greatness: some are born great, some achieve greatness and some have greatness thrust upon them". (Act II, Scene V). William Shakespeare born in 1564 into a middle-class family, whose father was a glove maker in Stratford-upon-Avon, a small market-town, achieved greatness. That greatness is matchless and the world has not produced another playwright of his name and fame! The multifarious characters one sees in his more than 37 plays reflect the tragedy, comedy and history of the era (1564-1616) to which he belonged. Shakespeare had deep understanding of human nature, social, economic and cultural conditions of his time. His characters come from many walks of life and he uses their language in his creative style. He had deep, intuitive knowledge of music, military science, politics, and hunting etc. His characters are as big as kings and generals, and as low as pick-pockets, drunkards and hired killers. He excelled dealing with philosophical topics. His characters spoke straight from the heart, as per their level of progression in the society. Elizabethan England and Shakespeare’s era are synonymous. What was the era like? There are many shades of opinions as for the living conditions prevailing then. Pritchard writes, â€Å"One would portray ‘merry England.’†¦.Another would present a typical third-world developing country, with gross disparities of wealth, with the powerful few plundering the Commonwealth, the numerous poor with low-life expectancy, traditional cultural patterns crumbling under the

Care of a Patient in the Mental Health Branch Essay

Care of a Patient in the Mental Health Branch - Essay Example The research paper â€Å"Care of a Patient in the Mental Health Branch† discusses the impact on the patient’s proper treatment and recovery process by a qualified nurse. The role of professional nursing in patient care can never be under-estimated. Nurses focus on the needs of the patient and provide individuals and their families with care and attention. The RCN defines Nursing as â€Å"the use of clinical judgment in the provision of care to enabled people to improve, maintain or recover health, to cope with health problems, and to achieve the best possible quality of life, whatever their disease or disability, until death†. The hiring and introduction of professional nurses to hospitals in the UK has had a profound and lasting impact on the health profession. The new role of the nurse as taught in colleges and universities is an expanding one and encompasses an array of new responsibilities. Where once upon a time, a nurse was content to stand by a doctor and see what he did, only speaking when spoken to and doing only as and when directed, today’s nurse has been given a role and responsibility almost equal to the doctor she is assisting on the case. Part of the enhancement of job responsibilities for professional nurses has been because of shortage of doctors or professional staff, the lack of proper interns and the general decline in health standards and patient care. Thus the expanded role of the professional nurse in the UK is making its impact felt not only on patient care but on the health profession as a whole.

Elder Mistreatment Essay Example for Free

Elder Mistreatment Essay Old age is generally a time for great life changes, stresses, and multiple losses for a maturing adult. An individual’s capacity to manage stress fluctuates with age. There are optimism and positive energy in youth, along with physical stamina to meet demands of life and cope up with conflict. With advancing age, and consequent physical illness, bereavement and fears, people suffer a deterioration of their mental stamina in negotiating challenges of life (Gonzalez et al. , 1988, 15). With an increasing sense of loneliness and insecurity about life, aging adult face a completely different level of problems that relate more to continuity, meaning and purposefulness of life, rather than meeting its material accomplishments. Elder mistreatment: Definition Defining elder mistreatment requires due consideration of a number of factors that vary from victim profiles to type and degree of abuse. Therefore to standardize its definition, elder mistreatment has been described as a process that starts with being overwhelmed that leads to abuse, mistreatment and neglect that causes suffering and pain for the victim (Johnson, 1991). Elder mistreatment deals with such issues as maltreatment, neglect, abuse, domestic violence, conflict and lapse in care management and physical and financial exploitation (Elder Abuse). Despite all the health management plans the fact remains that elder people are very vulnerable when it comes to health care. They are easily susceptible to diseases, illness, injuries, and psychological traumas that are consequences of aging (Pillemer and Wolf, 1986). These circumstances lead to abuse owing to isolation of According to national surveys, more than 49 percent of elder population reports abuse that range from neglect in providing basic amenities such as food, water, medicines, shelter, clothing, and timely medical treatment to denial of emotional and psychological support (Elder Abuse) With significant increase in America’s elder population, providing adequate elder care at family, social, and institutional level has become a major issue. The public conscience level for the major problems facing old age people are neglect, mistreatment and mismanagement in care related aspects has seen greater academic research to find out the causative factors behind elder neglect and mistreatment. Precipitators in elder mistreatment Contrary to the general perception of American family as one that is caring, considerate and loving towards its elder members, researches in elder neglect and abuse have shown that most of the neglect and mistreatment is inflicted at the hands of close family members (Pillemer and Wolf, 1986). In a report by National Elder Abuse Incidence Study on elder abuse, it was shown that majority of abuse on people aged 60 or more takes place in domestic quarters at hands of family members (Bergeron and Gray, 2003). Close relatives such as siblings, children and in several cases even spouses have been found to be responsible for neglect and abuse. Earlier conceptions of families being a safe heaven for elderly population received setback as definition of neglect broadened to comprise sensitive issues of psychological support, emotional care, empathy and understanding (Douglass et al, 1984). An issue of grave concern is the findings pointing to elder abuse and mistreatment taking place at professional health care and nursing institutions by nursing staff that is specifically trained for taking adequate care of elderly people (Johnson, 1991) Types of mistreatment afflicting elders Elder population suffers a wide range of mistreatment and abuse. The major types of mistreatments as described at Elder Abuse Help Guide are 1. Physical abuse of Elders: It includes physically maltreating old people, assaulting, beating, pushing, using physical restraints and manhandling. Physical abuse is relatively a rare phenomenon.   2.  Emotional abuse: Emotional abuse of elders includes verbal or non verbal expression of disconcert, insult, blame, verbal harassment, ridicule, intimidation, and yelling on part of care takers. Emotional mistreatment is one of most frequent and commonly occurring abuse that elders suffer throughout the nation. 3. Neglect: Elder neglect involves ignorance of basic needs and requirements of aged people, lack of shelter, absence of supervision and monitoring, deliberate delay or denial in providing medical care and inadequate personal and hygienic care. 4. Emotional Neglect: Emotional neglect leads to severe stress among old people.  They are deliberately ignored, left to fend for themselves, not taken care of in such activities in which they require support and help of care-takers. 5. Financial Abuse: Elders are often abused financially by exploiting their financial resources and denying them the privileges of their own assets. Elders subjected to financial abuse are often deliberately isolated from rest of world by their caretakers to avoid exposure and detection of their fraud. Financial abuse of elders is a common occurrence when elders are not staying with their blood-relatives but with near relatives or friends. Reasons and warnings of abuse In the researches in elder abuse, a pertinent focus of researchers has been on the causes that lead people to inflict abuse and mistreatment on people that are vulnerable, dependent and in need of love, care and emotional and often material support (Johnson, 1991). Finding the reasons for abuse becomes critical as it also acts as pointer to possible cases of abuses and mistreatment in many social and community settings where cases of abuse are not reported out of their sensitive nature. In explaining the cause of abuse, Bonnie and Wallace (2002) have presented a detailed socio-cultural model that identifies underlying processes in abuse Overview of model of elder mistreatment Meanwhile extensive research by a number of academicians and scholars has further helped to create a structured profile of abuser. An elderly person may be undergoing abuse or is highly susceptible for it when the caretakers show psychopathological tendencies, trans-generational discrepancies, stressful life, economic hardships, burnout, drug-dependency, drinking problem, degree of dependence that is greater than care takers’ ability to handle, coercive and dominating nature of caretaker, inexperience, lack of sympathy and inability to feel empathy (Anetzberger , 1987; Anastasio , 1981;Johnson, 1991). Elders may also be suffering abuse if they show constant fear of their care-giver, if there is a confrontational atmosphere around, and if they are get suddenly isolated, uncommunicative and pensive. Preventing Elder Abuse It is a poignant fact that elders themselves can do little in preventing their abuse. In case of people who are completely dependent on care-givers, such as Alzheimer’s patients and terminally ill patients, their survival depends on the care-givers and hence they rarely report abuse incidents out of fear of antagonizing their care-givers. Therefore to prevent elder abuse requires a broad program that should focus on development of services for elderly care, training sessions for care givers, initiation and integration of family members in the elderly care programs. Moreover, it is vital to pass the message that adequate, compassionate and empathic care of elders is a holistic issue, one that has long term defining impact on social culture and ethics.

Epigenetic Control of Endocannabinoid Function

Epigenetic Control of Endocannabinoid Function Janis Szeremeta Epigenetic control of endocannabinoid function Prostate cancer is one of the most frequently diagnosed types of tumours in the male population worldwide. The endocannabinoid system, more specifically high expression of cannabinoid receptor 1 (CB1) in tumour tissue, has been associated with poor prognosis in prostate cancer and suggested as a prognostic marker. Epigenetic silencing has previously been shown to upregulate CB1 mRNA expression in colon cancer cell lines and to induce expression of normally silenced cannabinoid receptor 2 (CB2) mRNA in a neuroblastoma cell line. In the present study, potential effects of epigenetic modulation on the expression of 12 different components of the endocannabinoid system (receptors, synthetic and catabolic enzymes) were investigated in a prostate cancer and a neuroblastoma cell line. Additionally, two catabolic pathways were investigated in functional assays. In general, changes in mRNA expression levels produced by treatment with the epigenetic modulators, 5-aza-2-deoxycytidine and Tricho statin A were small, and, in the case of the catabolic enzyme fatty acid amide hydrolase in DU-145 prostate cancer cells were not accompanied by observable changes in hydrolysis rates. In SH-SY5Y neuroblastoma cells a low expression of monoacylglycerol lipase was found and this was also observed in functional assays. It is concluded that for the cell lines investigated, the epigenetic modulators tested do not modify the endocannabinoid system to any obvious degree, at least at the mRNA level. Since these experiments were conducted on a single cell line of a specific cell type only, introduction of alternative prostate cancer cell lines, such as PC-3 or LNCaP, might have different outcomes and should be considered for future experiments. Due to its involvement in a variety of physiological and pathophysiological conditions, such as obesity, pain, immunomodulation and cancer1, the endocannabinoid system has emerged as an important area of research. Endogenous lipid transmitters, the so-called endocannabinoids, act by binding and activating the G-protein coupled cannabinoid receptors 1 and 2 (CB1/ CB2). Endocannabinoid levels are tightly regulated by a network of synthesizing and catabolizing enzymes (Figure 1). Two lipid mediators, N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoylglycerol (2-AG), remain the most thoroughly studied endocannabinoids to date. 2-AG is derived from hydrolysis of diacylglycerols (DAGs) containing arachidonic acid via diacylglycerol lipases ÃŽÂ ± and ÃŽÂ ² (DGLÃŽÂ ±/ÃŽÂ ²) and then hydrolysed to arachidonic acid mainly via monoacylglycerol lipase (MGL) but also by ÃŽÂ ±/ÃŽÂ ²-hydrolase domain containing 6 and 12 (ABHD6, ABHD12)2. AEA is derived from N-acylphos phatidylethanolamines (NAPEs) by hydrolysis via NAPE-phospholipase D (NAPE-PLD). It is inactivated by hydrolysis via fatty acid amide hydrolase (FAAH) and N-acylethanolamine acid amide hydrolase (NAAA) to arachidonic acid. Arachidonic acid is a substrate for many enzymes, including cyclooxygenase (COX) -1 and -2, 5- and 12-lipoxygenases (5/12-LOX) to produce prostaglandins, 5- and 12- hydroxyicosatetraenoic acid (5/12-HETE), respectively. Both 2-AG and AEA can also be hydrolysed to prostaglandin H2 derivatives via COX-23. Current modulators of the endocannabinoid system include a variety of selective pharmacological inhibitors for these enzymes which can be used to study their functional roles in the body (see Figure 1 for compounds used in this study). Figure 1: Simplified view of the endocannabinoid system. G-protein coupled receptors CB1 and CB2 are activated by lipid mediators, in this case 2-AG and anandamide (AEA) as well as by plant derived and synthetic compounds (not depicted). 2-AG and AEA are synthesized from diacylglycerol or N-acylphosphatidylethanolamine precursors and act locally. Both messengers are hydrolysed to arachidonic acid and/or prostaglandin H2 derivatives. Descriptions given in green were investigated towards changes in mRNA expression following epigenetic modulation treatment. Descriptions given in red show endocannabinoid metabolizing enzyme inhibitors. Abbreviations: Penta, Pentadecylamine (after Muccioli 20103). The endocannabinoid system is becoming a more and more important therapeutic target in cancer, and very interestingly, different types of cancer appear to react differently to changes in endocannabinoid balance, with oftentimes opposing effects ranging for example from pro- to antiapoptotic4. This shows why understanding how the endocannabinoid system is regulated in health and disease remains an important part of research. An important hallmark of cancer formation of cancer is the occurrence of epigenetic alterations5,6. Aberrant DNA methylation has been found in various types of cancer and effects vary between hyper- and hypomethylation states and in different types of cancer (see Kulis et al 20107). DNA methylation is usually associated with inhibition of gene expression. Cytosine nucleotides are methylated at the fifth carbon to form 5-methylcytosine, which can hinder transcription factor binding and therefore interfere with gene expression8. 5-Aza-2-deoxycytidine is a DNA demethylation compound that is able to replace and mimic cytosine in the DNA. In case of a cytosine replacement, DNA methyltransferases (DNMTs), that would normally catalyse methylation of cytosines, will now be bound covalently to 5-Aza-2-deoxycytidine, leading to degradation and depletion of DNMT protein levels and therefore a decrease of DNA methylation9. Note that this process is unspecific and generally decreases overall DNA methylation. Histone acetylation, a different type of epigenetic modification, is associated with activation of gene transcription. Occurring on lysine residues of histones, histone acetylation is associated with a charge neutralization of the positively charged histone molecules. This neutralization reaction is thought to decrease interaction between negatively charged DNA phosphate backbones and their positively charged histone counterparts, therefore increasing DNA availability10. Histone acetylation is regulated by an interplay of histone acetylases (HATs) and histone deacetylases (HDACs)11. Inhibition of HDACs may be used to constitutively activate histone acetylation mediated gene expression. Prostate cancer has become one of the most frequently diagnosed malignancies in men throughout Europe12. Current evidence suggests that high a CB1 receptor immunoreactivity is correlated to disease severity and outcome13. Several prostate cancer cell lines and human prostate cancer tissues have been shown to express CB1 receptors using various techniques, such as qPCR, immunofluorescence and western blotting13-16. There is evidence that CB1 expression is regulated epigenetically in colorectal cancer, where DNA hypermethylation lead to a loss of CB1 expression17. The same study found inhibition of epigenetic silencing (i.e. removal of DNA methylation) increased Cnr1 mRNA expression in seven out of eight colorectal cancer cell lines. A different study investigated the effects of two different epigenetic modulators, 5-Aza-2-deoxycytidine (Aza dC) and Trichostatin A (TSA), a histone deacetylase inhibitor, upon CB receptor expression in two different cell lines18. Inhibition of epigenetic silencing in Jurkat T cells increased Cnr1 mRNA expression in an additive manner but did not affect Cnr2 mRNA expression, whereas treatment of human SH-SY5Y neuroblastoma cells lead to induction of normally silenced Cnr2 mRNA expression, again in an additive manner, but no changes in Cnr1 mRNA. Whilst the above data implicate epigenetic regulation of CB receptors, it is not known whether it is seen in prostate cancer cells, and there is no data concerning the endocannabinoid synthetic and catabolic enzymes. In consequence, the present study investigated the effects of Aza dC and Trichostatin A treatment upon mRNA expression for 12 different endocannabinoid-related genes (see Figure 1). Differences that were found were investigated in hydrolysis experiments and changes in either AEA or 2-AG hydrolysis. In addition, since tumours are often located in hypoxic microenvironments19, cell lines were exposed to hypoxic conditions for increasing intervals up to 24 h and the same panel of endocannabinoid system components was investigated towards mRNA expression. Cells were either placed into anoxic incubation chambers or exposed to hypoxia mimetics such as Co(II)Cl220 or deferoxamine21. Drugs and Compounds Radiolabeled compounds ([3H]-2-OG (60 Ci/mmol)), [3H]-AEA (60 Ci/mmol)) were obtained from American Radiolabeled Chemicals Inc, St. Louis, MO, USA. URB597, JZL184, WWL70 were obtained from the Cayman Chemical Co. (Ann Arbor, MI, USA). Pentadecylamine, 5-Aza-2-deoxycytidine (Aza dC), Trichostatin A, Co(II)Cl2 were obtained from Sigma-Aldrich (St. Louis, MO, USA). Cell Culture Human DU-145 (prostate cancer, passage range 17 to 29) and SH-SY5Y (neuroblastoma, passage range 19 to 28) cells were expanded in Eagles Minimal Essential Medium (EMEM ATCC 30-2003) supplemented with penicillin, streptomycin (10,000 U/mL each, Gibco by Life Technologies) and 10% FBS (Gibco by Life Technologies) in 75 mL flasks at 37ËÅ ¡C with 5% atmospheric CO2. Cells were plated in 24 well plates with a total number of cells of 1.5 ÃÆ'- 105 for DU-145 and 2.5 ÃÆ'- 105 cells for SH-SY5Y per well overnight. Epigenetic Modulation using 5-Aza-2-deoxycytidine and Trichostatin A Following the overnight plating, DU-145 and SH-SY5Y cells were treated by replacing the old medium with a fresh layer of medium containing Aza dC (1  µM), Trichostatin A (25 nm), a combination of both, or vehicle (DMSO 0.1%) as control for 24 h. After 24 h hours, cells were lysed according to the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) instructions and mRNA was extracted. Exposure to Hypoxia/Hypoxia Mimetics Induction of hypoxia was achieved via two different methods. Cells were seeded into 24 well plates and either kept in a hypoxic environment or were exposed to the hypoxia mimetic Co(II)Cl2. A hypoxic atmosphere inside an airtight modular incubation chamber (Billups Rothenberg Inc, San Diego, CA, USA) was achieved by first flushing the medium with a hypoxic gas mix (1% O2, 99% CO2) at a rate of 3 L/min for 5 minutes. The old medium was replaced with a layer of flushed medium and plates were placed into the airtight chamber. The chamber was flushed with hypoxic gas at a rate of 20 L/min for 5 minutes (per manufacturers instructions22) and then incubated at 37ËÅ ¡C for either 2, 4, 6, 8 or 24 h. Co(II)Cl2 was used at a final concentration of 50 mM and cells were incubated for 2, 4, 6, 8 or 24 h. HIF1ÃŽÂ ± and HIF2ÃŽÂ ± mRNA levels were assessed for both procedures to evaluate induction of hypoxia. qPCR mRNA was extracted using the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit. mRNA (5  µg of total) was used for reverse transcription using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Thermo Fisher Scientific). qPCR reaction mixtures were prepared using the KAPA SYBR FAST qPCR Master Mix (2X, KAPA Biosystems, Wilmington, MA, USA) to a final Volume of 20  µL. Reactions were run on the Illumina Eco Real Time PCR system (Illumina Inc, San Diego, CA, USA) with an initial denaturation time of 10 minutes at 95ËÅ ¡C, 45 cycles of 10 seconds at 95ËÅ ¡C and 30 seconds at 60ËÅ ¡C and melting curve cycle times of 15 seconds at 95ËÅ ¡C, 15 seconds at 55ËÅ ¡C and a final step of 95ËÅ ¡C for an additional 15 seconds. Primers (Table 1) were synthesized at Integrated DNA Technologies (Coralville, IA, USA). Amounts of transcripts were normalized to ribosomal protein L19 (RPL19) and relative quantification was perf ormed using the ˆâ€  Ã‹â€ Ã¢â‚¬  Ct method. Table 1: primers used for qPCR experiments Gene Product Forward primer (5 to 3) Reverse primer (5 to 3) Abhd6 ABHD6 GATGTCCGCATCCCTCATAAC CCAGCACCTGGTCTTGTTTC Abhd12 ABHD12 GGCAGAAAGCTCTATAGCATCG CCTGTAGCCAAGGTCTGAATG Cnr1 CB1 CACCTTCCGCACCATCACCAC GTCTCCCGCAGTCATCTTCTCTTG Cnr2 CB2 1st pair CATGGAGGAATGCTGGGTGAC GAGGAAGGCGATGAACAGGAG CB2 2nd pair AAACAACTGGGACTCCTC GTCTAGAAGGCTTTGGGTTG Ptgs2 COX-2 AGCAGGCAGATGAAATACCAG ACCAGAAGGGCAGGATACA Dagla DAGLÃŽÂ ± CCCAAATGGCGGATCATCG GGCTGAGAGGGCTATAGTTAGG Daglb DAGLÃŽÂ ² TCAGGTGCTACGCCTTCTC TCACACTGAGCCTGGGAATC Faah FAAH CACACGCTGGTTCCCTTCTT GGGTCCACGAAATCACCTTTGA Hif1a HIF1ÃŽÂ ± GCTGATTTGTGAACCCATTCC TTCATATCCAGGCTGTGTCG Epas1 HIF2ÃŽÂ ± CACAGAGTTCTTGGGAGCAG ACCCTTTGCAGACCTTGTC Alox5 5-LOX ATCCAGCTCAACCAAATCCC ACCAGATGTGTTCGCAGAAG Alox12 12-LOX GATCCGAGGAGAGAAGCAATAC GGAGGCTGAATCTGGATGAC Alox15 15-LOX CGAGGGTTTCCTGTCTCTTTAC GCACCCAAGAGTACCAGTC Mgll MAGL GGAAACAGGACCTGAAGACC ACTGTCCGTCTGCATTGAC Naaa NAAA ATGGAGCGTGGTTCCGAGTT AGGCTGAGGTTTGCTTGTCCT Napepld NAPE-PLD ACTGGTTATTGCCCTGCTTT AATCCTTACAGCTTCTTCTGGG Rpl19 RPL19 CACATCCACAAGCTGAAGGCA CTTGCGTGCTTCCTTGGTCT [3H]-AEA Hydrolysis in DU-145 Cells The assay of Bjà ¶rklund et al. (2014)23 was used. Cells (1.5 ÃÆ'- 105 per well) were plated and kept overnight to allow for cell adherence. Subsequently, cells were treated with Aza dC (1  µM) for 24 h or left untreated as control. Non-enzymatic hydrolysis was measured in non-cell containing wells. Wells were washed with KRH buffer (120 mM NaCl, 4.7 mM KCl, 2.2 mM CaCl2.2H2O, 10 mM HEPES, 0.12 mM KH2PO4, 0.12 mM MgSO4 containing 1% BSA (Sigma Aldrich) followed by KRH buffer alone. KRH buffer containing 0.1% fatty-acid free BSA (Sigma Aldrich) was added to the wells and plates were kept in a water bath at 37ËÅ ¡C. Inhibitors (URB597 1  µM, Pentadecylamine 1  µM, URB597 and Pentadecylamine 1 µM each) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C. [3H]-AEA (diluted with non-radioactive AEA to give a final assay concentration of 0.5  µM) was added and plates were incubated for a further 15 minutes resulting in a total reaction vol ume of 400  µL. The hydrolysis reaction was stopped by adding 600  µL activated charcoal in 0.5 M hydrochloric acid and plates were kept on ice. Charcoal and aqueous phase were separated by centrifugation (2,500 rpm, 10 min.), 200  µL of the aqueous phase were recovered and mixed with 4 mL scintillation liquid (ULTIMA GOLD, PerkinElmer) for liquid scintillation radioactivity determination with quench correction. The [3H]-AEA used is labelled in the ethanolamine part of the molecule, and the [3H]-ethanolamine produced by the hydrolysis of [3H]-AEA does not adsorb to the charcoal, whereas the [3H]-AEA does adsorb24. [3H]-2-OG Hydrolysis in SH-SY5Y Cells Cells (2.5 ÃÆ'- 105 per well) were plated and incubated overnight to allow for cell adherence. Non-enzymatic hydrolysis was measured in non-cell containing wells. The assay used was the same as for [3H]-AEA hydrolysis, but using 0.5  µM [3H]-2-OG (labelled in the glycerol part of the molecule). Inhibitors (URB597 1  µM, JZL184 1  µM, WWL70 10  µM, a combination of URB597, JZL184 and WWL70 and a combination of JZL184 and WWL70 at the aforementioned concentrations) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C followed by addition of substrate and incubation for a further 15 min. See above for determination of radioactivity in aqueous phase. Cytotoxicity Assessment/Assay To determine the cytotoxicity of the various treatments throughout this project the LDH cytotoxicity detection kit from Roche (Cat. No. 11 644 793 001) was used per manufacturers protocol. Statistical Analyses Statistical analyses were undertaken by my Supervisor using the function ezANOVA in the package ez for the R statistical programme (R Core Team, URL http://www.R-project.org/). The details and the command lines used are given in Table 2. Epigenetic regulation of endocannabinoid function DU-145 and SH-SY5Y cells were treated for 24h with either Aza dC, TSA or a combination of both compounds, after which mRNA was extracted and analused for expression of marker of the endocannabinoid system. Table 2 shows the summarized data of the statistical analysis obtained in the gene expression studies. Main effects are given in the left half of the table. Significant differences were found for a various number of genes and are given in bold type. Main effects cell describes the comparison of gene expression between DU-145 and SH-SY5Y cells. The columns with Aza dC and TSA describe the effect of the epigenetic modulators on mRNA expression of the gene of interest and only a few of them were statistically significant (i.e. DGLÃŽÂ ² and FAAH for Aza dC and 12-LOX for TSA). Interpretation of the main effects is difficult when there are significant interactions. Values in bold type indicate an interaction between components) for four of the twelve genes of interest. In these cases, individual two-way ANOVAs helped to determine actual differences for each cell line per se. Results of these ANOVAs can be found below their corresponding figures (see Figure 2, Figure 3 and Figure 4) with a P Table 2: Three-way ANOVA summary for the PCR data. Main effects Interactions Cell: Cell: Cell: Aza dC: Aza dC: Protein Cell Aza dC TSA Aza dC TSA TSA TSA CB1 0.0003 0.31 0.060 0.38 0.89 0.14 0.30 NAPE-PLD 0.34 0.40 0.28 0.0093 0.29 0.29 0.54 DGLÃŽÂ ± 0.87 0.88 0.0049 0.49 0.16 0.61 DGLÃŽÂ ² 0.43 0.0004 0.027 0.020 0.031 0.88 0.96 FAAH 0.041 0.0061 0.55 0.17 0.85 NAAA 0.012 0.53 0.44 0.79 0.15 0.40 MGL 0.21 0.019 0.014 0.85 0.25 0.59 ABHD6 0.0004 0.019 0.15 0.0001 0.70 0.43 0.67 ABHD12 0.0078 0.014 0.65 0.091 0.14 0.61 0.11 COX2 0.032 0.62 0.21 0.70 0.83 0.74 5-LOX 0.99 0.45 0.21 0.91 0.98 0.13 0.53 12-LOX 0.0039 0.18 0.0001 0.41 0.55 0.93 0.69 Data shows the ANOVA p values for each protein, calculated for the data expressed as ˆâ€  Ct using the function ezANOVA in the package ez for the R statistical programme. The command line used was Model25). P values in bold type are those where significance remained after implementation of a 5% false discovery rate (Benjamini Hochberg, 199526). When the interaction cell type x Aza dC was significant, two-way ANOVA matching for Aza dC and TSA have been calculated for each cell type separately, and these are shown in the figures. Note that for DGLÃŽÂ ² and MGL the variances were different for the DU145 and SH-SY5Y cells and this will affect accuracy of the P values. In these cases, the cells have been analysed separately and the ANOVA values given in the figures. Cannabinoid receptors 1 and 2 Figure 2: Panel A, mRNA levels for CB1 receptors in DU145 and SH-SY5Y cells treated with Aza dC and/or TSA. The graphs show the individual ˆâ€  Ct values (bars show the means), N=6 per group (each assayed in triplicate), with the corresponding % of controls on the right column. For statistical treatment, see Table 2. Panel B, melting curves for the primers used for CB1 and CB2 receptors. The melting curves are for the DU145 cells. Gene expression analysis data of CB1 mRNA is given in Figure 2A. Expression rates were significantly different between the two cell lines, but neither Aza dC nor Trichostatin A had an effect. No interactions between the compounds and the cell types were found (Table 2) Unfortunately, two different primer pairs, designed to amplify Cnr2 mRNA did not give detectable and reproducible mRNA expression of CB2, so no expression data could be obtained for CB2 (Figure 1B). The first primer pair was taken from a previous publication by Bà ¶rner et al whereas the second pair was designed on site. Figure 1B shows the different melting curves obtained during the qPCR assays for DU-145, with similar results for SH-SY5Y cells. Endocannabinoid synthetic enzymes Figure 3: mRNA levels of the endocannabinoid synthetic enzymes NAPE-PLD (A), DGLÃŽÂ ± (B) and DGLÃŽÂ ² (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panels A and B) or when the variance was different for the two cell types (Panel C). Effects of epigenetic modulation on the expression of endocannabinoid synthetic enzymes are shown in Figure 2. No main effects of either Aza dC or TSA were detected for NAPE-PLD or DGLÃŽÂ ±, there was an interaction between the different cell types and the Aza dC treatment, however (see Table 2). For these samples a two-way ANOVA was calculated and values are given below each figure. Indiviual treatments did not have any significant effect on the expression of both NAPE-PLD and DGLÃŽÂ ± (Figure 2A and B), an additive effect of Aza dC and TSA could be observed for the expression of DGLÃŽÂ ± in DU-145 cells, where expression decreased to a small degree. For DGLÃŽÂ ², since the variance was different for both cell types, a two-way ANOVA was calculated for each. No significant effects were observed for DGLÃŽÂ ² expression in SH-SY5Y cells. However, both Aza dC and TSA had significant main effects in the DU-145 cells, although the sizes of the changes produced by the compou nds were very small (Figure 2C). AEA catabolic enzymes Figure 4: mRNA levels of the endocannabinoid catabolic enzymes FAAH (A) and NAAA (B). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel A). As seen in Table 2, Aza dC had both a significant main effect, but also displayed interaction between the cell types and the compound for FAAH. The two-way ANOVA for FAAH resulted in significant differences only for the Aza dC treatment in DU-145, but not in SH-SY5Y. Once again, the effects were very small in size. Trichsotatin A did not have an effect in either cell line, neither individually nor in combination (Figure 3A). No significant differences were found for NAAA (Figure 3B). 2-AG catabolic enzymes Figure 5: mRNA levels of the endocannabinoid catabolic enzymes MGL (A), ABHD6 (B) and ABHD12 (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel B) or when the variance was different for the two cell types (Panel A). Gene expression analysis of the three key enzym

HOW TO USE CABLE NUT :: essays research papers

CABLENUT ADJUSTER v4.08 Copyright (C) 2000,2001 CableNut Software - www.cablenut.com ------------------------------------------------------ Frequently Asked Questions (FAQ): http://www.cablenut.com, has a frequently asked questions guide as well as other content about the CableNut Software. INSTALLATION: The CableNut Adjuster is compatible with Windows 95/98/98SE/ME/NT/2000/XP each CCS file is tagged with an Operating System specific tag to show what Operating System it is compatible for. Explanation of specific terms are found below. 2K = Windows NT/2000/XP supported 9X = Windows 95/98/98SE/ME supported Cable_normal = Cable connections that can support up to 250KB/sec Cable_fast = Cable connections that can support over 250KB/sec Adsl_normal = Adsl connections that do not have the 1.5Mbps speed package Adsl_fast = Adsl connections that can achieve 1.5Mbps speed, or more ------------------------------------------------------ ADJUSTER.EXE  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Main CableNut program CABLENUT.HLP CableNut help file UNINST-CABLENUT.EXE CableNut uninstaller OFFICIAL SITE.URL Official CableNut site README.TXT Software readme info ..CCS/ CableNut Custom Settings (CCS) sub-folder 56K/ 56K_9X.CCS Dialup 56K modem tweak file for Windows 95/98/98SE/ME 56K_2K.CCS Dialup 56K modem tweak file for Windows NT/2000/XP Cable/ CABLE_NORMAL_9X.CCS Cable broadband tweak file for Windows 95/98/98SE/ME CABLE_NORMAL_2K.CCS Cable broadband tweak file for Windows NT/2000/XP CABLE_FAST_9X.CCS Cable broadband tweak file for Windows 95/98/98SE/ME CABLE_FAST_2K.CCS Cable broadband tweak file for Windows NT/2000/XP Adsl/ ADSL_NORMAL_9X.CCS Adsl broadband tweak file for Windows 95/98/98SE/ME ADSL_NORMAL_2K.CCS Adsl broadband tweak file for Windows NT/2000/XP ADSL_FAST_9X.CCS Adsl broadband tweak file for Windows 95/98/98SE/ME ADSL_FAST_2K.CCS Adsl broadband tweak file for Windows NT/2000/XP Satellite/ SATELLITE_9X.CCS Satellite Internet tweak file for Windows 95/98/98SE/ME SATELLITE_2K.CCS Satellite Internet tweak file for Windows NT/2000/XP ------------------------------------------------------ GETTING STARTED: 1. Locate the CCS sub-folder in the CableNut folder. (This can either be done by the desktop shortcut, the start menu shortcut, or by locating the CableNut install folder.) ------------------------------------------------------ 2. Run the CableNut Adjuster program. (Adjuster.exe - shortcuts are on the desktop, and in the start menu.) ------------------------------------------------------ 3. Select 'Open Custom Settings File' from the file menu. (This will load a specific CCS file into the Adjuster.) ------------------------------------------------------ 4. Select the correct CCS file that corresponds to your Internet connection. (All of the CableNut CCS files are located in the CCS sub-folder.) ------------------------------------------------------ 5. Click open on your selected CCS file. ------------------------------------------------------ 6. The values for the specific CCS will show. ------------------------------------------------------ 7. Press the 'Save to Registry' button. ------------------------------------------------------ 8. This will install the selected CableNut tweak file. ------------------------------------------------------ 9. Restart your system. (A restart is needed after every change in the Adjuster.) ------------------------------------------------------ 10. Your system is now tweaked for optimal Internet speed.

Comparing the Foreign Policy of Presidents George W. Bush and Bill Clin

Comparing the Foreign Policy of Presidents George W. Bush and Bill Clinton Towards North Korea Since its creation after the Korean War in 1950, North Korea, also known as the Democratic People Republic of Korea (DPRK), has caused many problems for the United States. North Korea has, for instance, broken treaties and even gone so far as to threaten the use of nuclear weapons. Naturally, different presidents have dealt with North Korea in different ways. Take Eisenhower for example, he actually threatened the use of nuclear weapons against North Korea in 1953 (obviously before North Korea had nuclear capabilities). Many presidents ignored North Korea all together, and some tried to ignore the country, but circumstances did not allow it. Two such presidents, Bill Clinton and George W. Bush, the 42nd and 43rd presidents respectively also tried at the beginning of their tenure as president to ignore the brewing problems in North Korea. Their indifference towards North Korea, however, was cut short, and they were both forced to engage the country early on in their respective admini strations. Their decisions in dealing with North Korea would help to define their early reputations as foreign policy makers. Their circumstances for being drawn into the affairs of North Korea were remarkably different (Clinton getting drawn in because of the threat of nuclear capabilities and Bush getting drawn in because of terrorism) as were their approaches to North Korea. Many similarities can be seen between Bush and Clinton's dealings with North Korea. Clinton started out, as mentioned before, trying to altogether ignore some eminent problems brewing in North Korea. In his Essay "Clinton's Foreign Policy in Somalia, Bosnia, Haiti, and North K... ...will not know the full effect of his presidency on North Korea until well after he is out of the White House. Until then, we will have to keep on making intelligent guesses as to where his policy will bring us in the future. Works Cited Dao, James. "Bush Administration Halts Payments to Send Oil to North Korea." New York Times 14 November 2002. Online ed. Hastedt, Glenn P. American Foreign Policy Past Present and Future, 5th ed. Prentice Hall: Upper Saddle River, NJ, 2003. Henirksen, Thomas H. "Clinton's Foreign Policy in Somalia, Bosnia, Haiti, and North Korea." Stanford: Stanford University, 1996. Sanger, Daved E. "North Korea Says it has Program on Nuclear Arms." New York Times 17 October 2002, Online ed. Shenon, Philip. "White House Rejects North Korean Offer for Talks." New York Times 4 October 2002, Online ed.

Rodriguez and Mexico :: essays research papers

Rodriguez characterizes Mexico as a country with a culture of tragedy and America as a country with a culture of comedy. However, America is comedic in the Greek sense-in the sense that America is not comedic at all. Rodriguez feels that Mexico, in being the place of tragedy, is better off. America, on the other hand, has to face the burden of optimism, and the subsequent let-downs. Thus, in a sense, he characterizes them in ways that oppose what he truly thinks of them.   Ã‚  Ã‚  Ã‚  Ã‚  Mexico is described as tragic-those who are of Mexican descent are often very traditional in thought. Rodriguez’s father held the traditional beliefs that old men are wise, that life is disheartening, and near one’s death is the point where one must look back on their life. However, he also feels that Mexico is a happier place, with sweeter children and more lavish funerals. Perhaps he views Mexico as the tragic place because it represents a lost heritage to him. He, who in his middle age, finds himself agreeing with the Mexican ideals, nevertheless finds himself affected by living in America. Instead of being raised with the ideas of Mexican culture, he was raised with Protestant optimism characteristic of California. He was forced to abandon the way of life of his ancestors, even if only partially. America-more specifically, California, conquered the Mexican ways, and in so doing, lost the opportunity to reconcile the Catholic South and the Protest ant North. Thus, Mexico emerged as the tragic hero and California as the laughing victor. California is comedic because it is a place where it is possible to start anew, to defy the traditional.   Ã‚  Ã‚  Ã‚  Ã‚  Rodriguez views California as a reconciliation between comedy and tragedy. It is both the place where many Mexicans immigrated to and the place where Americans move to escape the constraints of society. Mexicans hoped to experience the comedy of California-where it is possible to change your sex, divorce, and become famous. Even Rodriguez’s parents moved to California, and live in a house with many telephones and televisions.

Asses the Significance of the Treaty of Versailles

The Treaty of Versailles did not dismantle Germany from its ability to wage war; it neither made the people grateful towards the allies. As the Italian political philosopher Niccolo Machiavelli of the 1500’s stated â€Å"___________†. The Treaty imposed many demands of the war weary country, these demands did not have an immediate effect on the country, and it instead gave a long-term legacy of bitterness and humiliation. The defeat of the German military was a shock to most Germans, as they were made to believe that they would be the victors in the â€Å"Great War†. The Treaty came as an equal shock, as it gave the government no chance to negotiate the terms. The terms included military provisions to be changed, territories to be given away and reparations to be paid. The military of Germany was to be reduced to 100,000 and Germany was not allowed to produce any guns, poisonous gas or tanks. These terms affected many Germans especially wealthy industrialists who made large profits from the business. Those thousands employed into factories to build weapons also lost their jobs. The German military was at a time four million strong before the war with the reduced military this put thousands of trained men onto the streets without employment, these men would prove later to be enemies of the new republic. The German General Staff was dismantled, therefore putting influential generals such as Ludendorff and Hindenburg unemployed but most importantly there loyalty was to nobody since the Kaiser abdicated. This allowed ambitious politicians to take advantage of the famed generals as they persuaded them to join their political parties. An example of this is Hitler having Ludendorff join him in his 1924 failed Munich Beerhall Putsch, he was used as a symbolic figure supporting Hitler’s regime. The powerful navy that German had, was to be reduced to a mere few ships, and the U-boats were strictly forbidden. This had the same affect as it did with the army; it put hundreds of sailors on the streets unemployed and angry. Since it was not the Military that decided to sign the armistice they felt a sense of betrayal from the new government. This was to be called the â€Å"Stab in the back† theory, which was used by the military to explain why they were defeated and recalled. This theory was made to preserve the unscathed honor of the German military. The territories that the Treaty demanded were immense. The long held provinces of Alsace and Lorraine were taken by France. These provinces had been held by Germany since 1871, the people were a generation of Germans and the immediate change came as a shock. The Allies also claimed economic control over the rich coal-producing area of the Saar basin, its workers were German but the production was to go to France. This had a dramatic effect on the amount of coal German was producing, before the war Germany war producing 277 million tonnes and 14 million tonnes of steel. Because of the economic control of the Saar basin both of these vast industries were badly disabled, this therefore effected Germany producing an effective income from these industries that it prospered. The large region of Posen was created into a new country called Poland, but the allies determined that the new nation needed access to the sea. Therefore part of West Prussia was given to Poland, this area was called the Polish Corridor where many Germans lived, now under the new country Poland. The large city of Danzig was also taken from Germany and taken by the control of the new-formed League of Nations. Schleswig a region farthest north of Germany and south of Denmark was to be given to the government of Denmark, as the regions of Eupen and Malemdy was given to Belgium. The large area of the Rhine land, which lied on the border of Belgium and France, was to be demilitarized effectively stopping any further motivations to invade France. Germany had ten colonies based in Africa and Asia; these colonies had an overall population of fifteen million, adding trade and tax income to Germany’s government. But the Allies stated in the Treaty that Germany was â€Å"Colonially Unworthy† and as a result lost control of all her colonies. These colonies were controlled and administrated by the League of Nations. All these territorial demands from the Treaty of Versailles not only had an economic impact to the German country but it had a morale effect of humiliation to the German populace. Many articles in German Newspapers such as the Deutsche Zeitung stated, â€Å"German honor is being carried into its grave†¦. The German people will with unceasing labor press forward to reconquer the place among nations to which it is entitled. † and as well politicians used this as propaganda promising that their party will reclaim German honor. The Treaty also forced Germany to take full responsibility of the war. The Allies made them accept that it was their fault and that the countries all suffered because of Germanys selfishness. Because they were blamed for the war the Allies saw fit that they were to pay for the reparations of the war. This amount concluded to 32 billion American dollars, this was but a mere partial cost to the war but Germany still tried to resist paying the total amount. The reparations were not paid until 1921 a full three years after the signing of the Treaty. The initial German reaction the terms of the treaty was shock and anger. Since the Kaiser abdicated it fell upon the new government to sign the treaty, because of this the Weimar Republic was always held accountable for disgracing Germany. There were many in Germany, who urged a rejection of the treaty like Hindenburg, but many more had a realistic perspective and insisted that the government sign it; these people were General Groener and other members of the Reichstag. The initial anger and outbursts the treaty invoked on the people was of hopelessness, the reality was that Germany had little choice other than to accept the treaty. If the Government did not sign the Treaty the country would have been dismantled like it was after World War 2. The Treaty of Versailles importance is clearly exemplified in its determined effect of Germany. The country lost about thirteen percent of its territory, 12 percent of its population and a combined 64 percent of its iron and coal industries. But Germany still remained one of the strongest countries on the continent. As the Treaty effected the country on an emotionally level, the Germans of all classes were disgraced and angry at the Weimar Republic for signing the treaty. The Treaty obviously did not destroy Germanys ability to create an army (WW2) nor did it encourage them to not go to war. The effect of the Treaty forced a generation of Germans to swear vengeance on the Allies.

Macbeth Explication: “If it were done when ’tis done” Essay

The final scene of the first act opens up with a powerful soliloquy presented by Macbeth, If it were done when tis done (I.7.1-28). Shakespeare uses various literary techniques to express the ideas rushing through Macbeths mind prior to the murder of Duncan in his home. In previous scenes, Macbeth has been told prophecies of his future predicting him as king of Scotland, Duncans current position. Macbeth, with the aid of his wife, sees this task accomplishable only by the murder of the current king. This soliloquy presents itself at a crucial point of decision, only hours before the opportune minute of attack The soliloquy opens with Macbeths ideas on how he would hope the murder to be. If it were done when ’tis done, then ’twere well / It were done quickly (I.7.1-2). These two lines show how indecisive Macbeth is about committing the crime. He is saying that if the murder be done, it should be done fast. The if shows that Macbeth is unsure that he wants to follow through with the initial plan. Shakespeare also shows that Macbeth wishes to get it over and done with, showing haste and not thinking it out properly. If the assassination / Could trammel up the consequence, and catch / With his surcease success; that but this blow / Might be the be-all and the end-all here, / But here, upon this bank and shoal of time, / We’d jump the life to come. (I.7.2-7). Here, Shakespeare uses a metaphor to compare the murder as something that could be caught and once caught; it would not yield any consequences. He then goes on to say that in the real-world, this cannot be true. Shakespeare craft fully shows that Macbeth knows that their will be consequences to the murder and that thinking that everything will be okay is not a logical thought. Macbeth continues, But in these cases / We still have judgment here, that we but teach / Bloody instructions, which, being taught, return / To plague th’ inventor: this even-handed justice / Commends the ingredients of our poisoned chalice / To our own lips. (I.7.7-12). Macbeth states that he still has the choice whether to commit the murder or not to. Shakespeare uses a metaphor to compare the murder with bloody instructions being taught. Macbeth also says that the person who commits the murder (or teaches the bloody instructions), come back to the murderer (or inventor). By saying  this, Shakespeare throws in the element of Macbeth foreshadowing his own demise. He then goes on to compare the return of the misdeeds through the imagery of a poisoned cup. He speaks of how the poisoned chalice, although used on others, will once again come around to his own lips. Macbeth begins to give and weigh reasons for and against Duncans murder. He’s here in double trust: / First, as I am his kinsman and his subject, / Strong both against the deed; (I.7.12-14). Macbeth states that Duncan trusts him in two ways, first of which as his loyal solider. Macbeth then explains how he is expected to be loyal to his king and protect him; not the contrary. In these lines, Shakespeare includes the irony that Macbeth plans on doing what he is supposed to prevent. Macbeth continues, then, as his host, / Who should against his murderer shut the door, / Not bear the knife myself. (I.7.14-16). Here, Macbeth states that he is, secondly, Duncans host. Therefore, Macbeth should be protecting Duncan against a murderer, rather than killing Duncan himself. Shakespeare uses the same irony as in the preceding lines. Macbeth continues with reasons against the murder. Besides, this Duncan / Hath borne his faculties so meek, hath been / So clear in his great office (I.7.16-18). Here Macbeth states that Duncan has always been good to him and never abused his power. Macbeth now switches over to the topic of what will happen if Duncan is murdered. that his virtues / Will plead like angels, trumpet-tongued, against / The deep damnation of his taking-off (I.7.18-20). Shakespeare uses personification and a simile to compare what will happen to Duncans virtues after the murder. He describes Duncans virtues as angels, who with spread the news of his murder to all. He proceeds, And pity, like a naked newborn babe, / Striding the blast, or heaven’s cherubim, horsed / Upon the sightless couriers of the air, / Shall blow the horrid deed in every eye, (I.7.21-24). Shakespeare again uses a simile to compare the pity of the people over Duncans death to a newborn  baby. Shakespeare then uses imagery to convey a picture of how fast and gracefully the news will spread; a baby, a common representation of innocence, whisking through the air, telling everyone about the deed that took place. In the succeeding line, Macbeth predicts, That tears shall drown the wind. (I.7.25). Here, Shakespeare uses vivid imagery to describe the mood of the people after the death. People will be distraught over this occurrence and will weep as rain falls from the sky. In the conclusive lines of the soliloquy, Macbeth poses the sole reason he has for the murder, I have no spur / To prick the sides of my intent, but only / Vaulting ambition, which o’erleaps itself / And falls on th’ other. (I.7.25-28). Macbeth here says that he has absolutely no reason to kill Duncan, save for his ambition. In his final sentence, Shakespeare then personifies his ambition as overleaping which falls over itself. Macbeths ambition overleaping and falling also foreshadows Macbeths death. After the soliloquy, Macbeth changes his mind and no longer wishes to kill Duncan. But with the persuasion of his wife, changes his stance again and goes through with the murder. All of the events, the spreading of the news of the murder, the consequences of the assassination, people hysteria and Macbeths own downfall, which Macbeth foreshadowed in his soliloquy, do prove accurate.

R.M.’s symptoms Essay

1. Compare her VS with those of a healthy person at her same age. R.M.’s temperature is low: 96.8 F and normal range is 97.8 -99 F R.M.’s blood pressure is elevated: 142/84 and normal range is 120/80 R.M.’s heart rate is low: 52 and normal range is 60-100 R.M.’s respiratory rate is on the low end of normal: 12 and normal range is 12-25. 2. List eight general questions you might ask R.M. to assist in determining what is going on with her. Does your family history of thyroid, adrenal, or pituitary disease? Have your menstrual periods been altered? What have your sleep patterns been like? Have you been exceptionally nervous? How has your appetite been over the past 6 months Have you had weight fluctuation over the past 6 months Is there a history of diabetes in your family? Have you had any radiation therapy to your head and or neck? 3. You know that potential causes for some of R.M.’s symptoms include depression, hypothyroidism, anemia, cardiac disease, fluid and electrolyte imbalance, and allergies. As part of your screening procedures, describe how you would begin to investigate which of these conditions probably do not account for R.M.’s symptoms. As part of screening procedure, e began our investigation by focusing on auscultation of the heart and lung sounds for sign and symptoms of cardiac disease or problem. However, there are no abnormalities present with R.M.’s heart. According to R.M.’s symptoms, it is clear that she does not have any signs of cardiac disease, symptoms of allergies, and fluid and electrolyte imbalance. R.M. has symptoms of hypothyroidism, anemia, and depression. 4. Unnecessary diagnostic tests are expensive. What tests do you think would  be the most appropriate for R.M., and why? We think that thyroxine, (T4), and pituitary thyroid-stimulating hormone (TSH) will be appropriate for R.M. because this test will confirm the diagnosis of thyroid failure. Cholesterol levels need to be checked and also other blood tests needs to be performed to detect levels of calcitonin, calcium, prolactin, and thyroglobulin and check for anemia and liver function. All these tests can be affected by hypothyroidism. 5. Interpret R.M.’S laboratory results. 6. The family practitioner affirms a diagnostic of hypothyroidism. With this diagnosis, what other signs and symptoms would you want to investigate? Other signs and symptoms we would want to investigate include impaired memory, depression, elevated blood cholesterol level, irregular menstrual periods, and stiffness or swelling in the joints (Mayo, 2014). http://www.mayoclinic.org/diseases-conditions/hypothyroidism/basics/symptoms/con-20021179 7. The family practitioner prescribes levothyroxine (Synthroid) 1.7 mcg/Kg body weigh/day. At this time. R.M. weighs 130 pounds. What should be her daily dose of Levothyroxine in milligrams? How would her prescription read?

Organizational Analysis: Apple Inc. Essay

Apple Inc. is an iconic United States technological company based in Cupertino, California. Apple is engaged in the development of World changing consumer electronic products such a mobile phones, music media devices, tablets, and personal computers. The company also sells and creates operating system software, peripherals and delivery of third-party digital content (iTunes) to consumers. Apple sells its products and services via it 250 U.S. and 140 international retail stores worldwide (Europe, Japan and Asia-Pacific), online stores and third-party wholesalers, retailers and resellers. As of September 29, 2012 Apple has 72,800 full-time employees and 3,300 temporary employees and contractors. Apple is one of the largest and most innovative companies in the world with increased net sales from $65 billion in 2010, $108 billion in 2011 and $156 billion in 2012. (Apple 10K) Two young entrepreneurs; Steve Jobs and Steve Wozniak founded the company in 1997. They relied on each other different strengths to propel the business forward. Wozniak was the technical know person and Jobs was the visionary who knew how to conceptualize the product. One of their early computer products was called Apple II. The next big product that brought Apple to the forefront of the computer industry was the introduction of the first Macintosh computer reveled to the world in 1984. Apple spent over 30 million dollars on the advertising of the product, which also launched the famous and iconic television ad that ran during the Super Bowl. Over the years the company has survived management conflicts were Steve Jobs left the company for many years, but was brought back 1997 to help revive Apple from dismal stock prices and competitors. In short, under Steve Jobs leadership the company shifted its focus towards making the best innovative and uniquely designed products Worldwide for consumers. (WPost) Structure: Organizational structure that keeps Apple â€Å"alive† is uniquely different than other multinational companies, but they still follow distinct rules of a well-function organization. To help understand Apple’s structure, we first need to look what is the company’s purpose. Apple wants to be number one at creating some of the best and innovative products for consumers that brings life changing user experience to customers. Formalization – Apple is derived from the create quadrant of the CVF were they pay close attention innovation and envision the future, but at the same they also have a very formal structure that is running in full start-up mode at all times and they can still take part in spontaneous actions without the politics and red tape of normal large companies Centralization – One of the key drives of Apple’s corporation is that they are a highly collaborative company that works really well together in the decision making process, but I would also say they are combination of a highly centralized and decentralized type of business. Hierarchy – Consisted of Steve Jobs being the visionary and visible leader of the company till his recent death. The person now steering the ship is Tim Cook, who is a veteran Apple employee and has been appointed several times as stand-in CEO in the past. Apple has what would be considered a tall organizational structure, but still unique because of how they foster collaboration. Complexity – Like any large multinational company Apple has an array of 10 Top Executives, Board of Directors and a CEO Tim Cook (Apple bios). Integration – Apple is a highly integrated organization, but once again due to how collaborative the company is, different organizational units and sub-units work very well together to meet the core objectives and goals of the company. Leader-Follower Relationships: Apple is probably one of the best in the tech industry, even though Steve Jobs has passed away. â€Å"Entrepreneurial leaders leave a lasting imprint on the structures on the organizations they found,† which is the case with Apple being led by Tim Cook now. The management styles are a little bit different between the two men, but the revenue numbers speak for themself in this situation. Apple’s structure allows the current CEO to carry on with business as it did in the past with the exception of trying figure out what would Steve Jobs do in this scenario of keeping Apple a vibrant company. Steve Jobs watched companies like Walt Disney be non-productive after their CEO passed away and did not want that for Apple, so he explained to Tim Cook â€Å"don’t ever try to figure out what would I have done in a certain situation, just do what is right for the company† (MSNBC). I think this type of leader-follower relationship transcends throughout the Apple organiza tion very well. Stakeholder relationships on the surface seem to be in very good standings. Apple is a leader in so many ways with making superior products; they are number one, who doesn’t want to be a part of the Apple machine? For example, the recently opened Apple store in Grand Central Station, all forms of stakeholders are benefiting from that deal; consumers, employees, Grand Central, New York City etc. Multiply that by various locations around the world and we have a majority of happy stakeholders ready to follow with open arms all because of the structure of how Apple operates its company. Productivity and performance due the company’s organizational structure allows Apple to be number one. For example, when netbooks were all the rage and Apple was introducing the first iPad and started coining the phrase we are now entering into â€Å"post-pc era,† some people or industries did not take that statement serious, but look at the numbers now. 95% of all web traffic from tablets are from iPads and it is only increasing every year (AllthingsD). The benefit and cost of the current structure is very evident all over the world, especially when Apple has a new product launch. It’s like a cult following (in a good way). For example, people start lining up all over the world; to get their hands on whatever product is being released; online sales via Apples website will start to have a 3 to 4 weeks backorder on products because they are in such high demand. Basically the current structure allows Apple to achieve high net sales on all products being sold and keeps their position as number one consumer product seller in the world. Culture At Apple, the work culture was driven by a passion for new products with no end to challenges and opportunities. Apple became the pioneer of the â€Å"Work Hard Play Hard† ethic. The corporate culture at Apple was exemplified by its intense work ethics. Al though it’s work environment was relaxed and casual, there was a very strong commitment to company deadlines. Apple was based on an idea that self-motivated individuals will work harder if they do not have a boss micromanaging every action. This unique structure of Apple had allowed it to grow and react more quickly to changes than its competitors like IBM and Microsoft. The reason Apple took action to a quick responsiveness, is that it was much easier to get a project started if there are only a few people to obtain approval from. One view of Apple’s leader follower relationship can be explained by how quickly Apple initially grew. Due to the ability to have employees make decisions at the lowest possible level. Corporate headquarters made policy and oversaw all activities, but the local employees made the day-to-day decisions in countries all over the world. This type of top-down philosophy allowed for quick responsiveness and resolutions to situations without involving the corporate headquarters, thus avoiding corporate red tape. Analysts have been known to summarize the work culture at Apple as fun, yet demanding. â€Å"Culture helps focus individual effort directly on achieving the organization’s objectives.† (Greenwald, P207) The Apple experience as a stakeholder has always been about the user experience not just the technology, even though the majority of the market didn’t care about that Apple wanted to be different. Apple is a company that is in the business of making markets vs. addressing markets. The Apple ego is a belief that it is the best company in the world and it should carry itself that way, all its lenders, employees, software designers and customers understand its ego and for those who don’t like it found out it has become a call to arms for all of the company’s stakeholders. Another way to view Apple is that it doesn’t ask people what they need but gives them products they decide they want. Think about a simple question, does anyone need an iPhone or iPad? Not really, but a lot of people seem to want them. Apple’s culture is based on some basic facts that really drive its productivity performance. It is a vertical integration company where most of technology is developed in house for its key products and it will have key advantages over other less vertically integrated companies and Apple makes â€Å"cool† products. Attention to design and detail, fit and finish really distinguishes Apple’s products from competitors. The iPod was not the first digital music player and the iPhone was not the first smart phone and the iPad is not the first portable computing device. But having differentiated business models where Apple develops and innovates products with key features like the iPod+iTunes and iPhone+App Store provides a strong competitive advantage, where this process makes it difficult for competitors to match what Apple is producing in a timely fashion. Apples culture produces and offers very clear and simple set of products. It’s easy to understand the differences between their products, product families and the various configurations where many other companies complicate things unnecessarily. Apple’s employees had to run their own show and work in a challenging and creative environment. Apple adopted a style that was not too formal or hierarchical and a more results-driven approach, which worked best for them. Apple fostered a culture of secrecy. The demand for absolute secrecy and insistence on control were infused into the company culture right from the beginning. â€Å"My job is to not be easy on people. My job is to make them better.†(Steve Jobs, 2010) Human behavior The understanding of the human behavior at the Apple organization has truly shaped its design, structure, function and culture by the following points. * Apple employees understand that a key internal emphasis at the company is that it cares about the design of its products more than any other firm in the market, unlike Microsoft who has done a poor job of creating aesthetically pleasing products. Apple’s focus on design shows it understands what consumers want and how to meet those needs and desires, and it sets out to beat any and all expectations. The pressure falls onto an employee who doesn’t help the company meet those needs they may end up with another company sooner than later. * Apple is known to do everything differently; therefore employees need to forget what they ever knew about the technology world. Whether it’s the design of products, system for developing ideas for new products or the way it handles data everything is different at Apple. Employees who function similar to a past employer is a mistake that could cause trouble within the rank and file. * Apple takes it flaws to heart and listens when it hears people criticize its products. They respond with firm tone and harsh statements in ways that other companies in the industry would not dare to replicate. Apple doesn’t like being told that it’s wrong. * Apple will never admit defeat no matter how badly its products are getting beaten. The company seems to find ways of turning itself around and out of the hole with an right strategies business action that saves the day. Nowhere is that more evident than in the computing market. With the results that Apple is setting record profits. * Apple understands attention to detail is key strategy that will pay off in the long run. Apple goes that extra mile which has become a staple of the company’s vision and it’s something that it expects from its employees. * Apple’s focus on technology domination worldwide is everything that the late Steve Jobs aspired to be. It was his ultimate goal to not only compete with his competitors in the all the markets his company competes in but rather destroy them. He wanted to make it clear to the world that his company was the best and would beat them all. At apple he established a culture that would help him achieve his legacy. Communication and decision making styles We know that the form of communication within an organization is directly reflective of its structure. Information is transmitted through diverse methods such as speech, writing, symbols, and body language. (Greenwald, Organizations; Management without controls, 2008) At Apple, communication is what they sell and what they welcome. â€Å"Whether or not you as an Apple employee choose to create or participate in a blog, wiki, online social network or any other form of online publishing or discussion is your own choice. In general, what you do on your own time is your business. However, activities that affect your job performance, the performance of other Apple employees, or Apple’s business interests are still covered by company policies and guidelines. This applies whether you engage in these activities in or outside of work, and whether or not you identify yourself as an Apple employee.† (Heath, Alex, 2012) It is clear that Apple knows that it is to protect itself from the very creative minds it cultivates. This policy leaves no room for unnecessary overlap. Business is business and that is what matters. â€Å"Apple runs an extremely tight ship, with tiny product groups; just two engineers were given the task of writing the code to convert the Safari browser to run on the iPad, a task that on its face seems like a huge undertaking that other companies such as Microsoft or Google might have devoted dozens of people to.† (The Dictatorship, 12) Apple, as a formal organization has had a long history of capturing informal leaders. The previous excerpt is from an article, which also describes the gathering of 100 exclusive employees. They were not all at same pay grade and or security clearances but they could be trusted to keep dates and products a secret as well as to give their honest opinions. â€Å"Every executive action, product or project has a â€Å"DRI† – directly responsible individual – who carries the can (or laurels) for its outcome.† (Heath, Alex, 2012) â€Å"The creative process at Apple is one of constantly preparing someone – be it one’s boss, boss’s boss, or oneself – for a presentation to Jobs,† writes Adam Lashinsky, who calls him â€Å"a corporate dictator who makes every critical decision – and oddles of seemingly noncritical calls too†. (Heath, Alex, 2012) While Apple does subscribe to what may be considered a ‘normal’ type of policy and set of norms, we often learn of the overlapping, dictator-ran, bully-driven ship that shines through in their product releases and market bravado. Observations: Our observations of Apple employees are limited to Apple Store ® employees. Although we have included various reports and accounts of encounters between Steve Jobs and other executives, we find it necessary to compare the culture levels on the outer bands of this grand organization. Passing by the Apple Store in any mall, it is apparent how different the selling atmosphere is. The products are all sprawled out for customers to play with and engage in. There is nearly a 1:1 staff/customer ratio. They have a â€Å"genius bar† where any consumer holding a MAC product can bring their device to for assistance. The environment is alive and vibrant. These geniuses are the face of the company to the everyday employee and they are raised and bread by Apple. They are taught communication styles, they are integrated into the norms and values of the Apple brand and they execute a marketing and sales strategy that benefits the customers and the company. This is done through verbal communication, non-verbal communication and symbolic communication. The entire store is a symbol of Apple. The training manual for the Apple Genius explicitly trains the employees on nonverbal queues and communications to control each interaction (Biddle, 2012). Apple Inc. executives could teach a PhD level course in human behavior and how to influence. It. Just as with any other product or organization, saturation levels are pushed if we don’t pay special attention to how we grow our business. In the early stages, Apple was more of a novelty and so could afford to hire ‘like’ minds to mind their storefronts. Having to expand its numbers in an effort to combat other retailers for sales, Apple has had to let in a second tier of mildly interested individuals who would be just as happy working for Geek squad ® at BestBuy ® or any other tech driven retail outlet. The promise of â€Å"first dib’s† and other benefits are now comparable to family discounts received throughout the malls. This is not only acceptable but it is a welcomed change in personnel type for Apple ®. The dictatorship can freely set plans for stores without worrying about everyone trying to become the next ‘Steve Jobs’. Part 2 – Team Analysis Team Formation: The team assignment was posted to the module 3 team assignment, but did not clearly state who the teams were comprised of. In an effort to be proactive and to get started on creating a team, Jim reached out to the entire class to try and obtain volunteers to work as a team to complete the assignment. Team member volunteers emailed Jim expressing their interest. Thirty minutes after his initial email, our team was formed. Initially the team consisted of Jim Fiorino, Amber Winters, Jason Shanks, Khari Clarendon, Kevin Connolly, and Michael Keys. Shortly after we formed this team, Dr. Kymn clarified team assignments and sent out communication to the class helping to bring clarity to the assignment. Dr. Kymn honored our volunteer formed team, minus Kevin who had previously left our class. The team formed is a formal organization, working and communicating with each other according to standardized patterns recognizable by everyone (Greenwald, 2008) as students under the larger group we all belong to, the Empire State MBA program. The team selection process reflected our coursework in our Human Systems and Behavior class, as well as earlier class work specifically Competing Values Framework (CVF). Our team has charged itself with finding the perfect balance to the 4 quadrants of the CVF, COLLABORATE, CREATE, COMPETE and CONTROL. The entire team is a group of independent and busy individuals who are all focused on completing the assignment on time, and making sure that we all contribute equally to the assignment given. Team members agreed to be flexible and focused in this process with the ultimate goal in site, a successful organizational analysis. Organization Selection Process: A list of companies was suggested via course email by Michael Keys and was sent to the team for consideration. The list included The Apple Store, Home Depot, Target, Macy’s, and Gap stores. Through email discussions, it was decided by consensus that the group would analyze Apple stores. Mike in the role of team liaison, texted Dr. Kymn with our result, and our selection was approved. Self managing teams are defined as groups of workers assigned the responsibility for making decisions over the manner in which work will be carried out, setting schedules, assigning individuals to perform specific functions, and evaluating members’ performance (Greenwald, Organizations. Management Without Control, 2008). This is a true example of our team, we all need to manage our own time and make decisions that are going to support the timelines discussed on our conference call and complete the specific assignments (specific functions) described earlier. Team Roles and Tasks Roles naturally defined themselves as our team members learned more about each other. Jim’s initial outreach to the entire class identified him as our team’s natural LEADER and PROJECT MANAGER. He was charged with keeping the team on task, on time and on topic. He also promoted positive and timely communication, key to the success of any organization. Our group by nature, is limited to strictly verbal/written communication in our virtual learning environment. This communication mode is characterized by use of words and numbers. Verbal communication has clear advantages over other modes for the exchange of deliberate messages. Transmission of data is always a verbal process (Greenwald, 2008). Amber took on the role of EDITOR and PROOFREADER. A major challenge of the approach our team took to writing this paper was creating it in five voices. The role of editor is important to put the paper in one voice. She also is responsible for reviewing the paper of grammar and typos. The team members shared a few common roles. We all played the role of TEAM MEMBER, RESEARCHER and WRITER. By assigning sections to each team member, we were individually responsible for researching our portion. Following the compilation of our research, we were each independently responsible for writing our 2 page section. Team Responsibilities: After agreeing on the organization to analyze, Jim reached out to the team and we agreed to have a conference call on Sunday December 9th to discuss next steps and to assign the work. Prior to the call Mike had sent out an email stating that he had already completed sections A & B of part 2, which was a great way to get everyone motivated on getting this assignment completed early. During the conference call, the work was split up among the team. Mike already completed A & B, Jason was assigned C & D, Khari was assigned E & F, and Amber was assigned G. Jim volunteered to take all of part two, the team analysis. During this meeting it was agreed that all team members would try and write two pages on their sections to meet the minimum assignment target of ten pages if the content. We agreed that each of our sections were to be completed by Wednesday night and emailed to Jim all of our work can be consolidate and sent over to Amber to allow her time to complete her part of the assignment. During this conference call we all agreed that we will regroup on Wednesday December 12th, to make sure that we are all complete with our sections and to seek assistance if needed. Team Outcomes: Our successful organization, role structure and communication allowed our team to be productive and successful. There were no disagreements or conflict and we all agreed that we want to complete the assignment early, but be successful in doing so. The entire team worked collaboratively with good discussions through positive verbal communication. . All of us shared in ideas and agreed on a time commitment and schedule. People who are collaborative share the same objectives, mutual and equal contributions, and a sense of collectivity among the group, producing a work environment that is free of conflict and tension (Cameron, Quinn, Degraff, & Thakor, 2006). Our two page sections were all emailed to our TEAM LEADER on time. He combined them and sent them to Amber for review and editing and for the summary to be completed. All team members met their obligations as agreed. Team Assessment: Our team can be defined as a high performance team. A high-performance team can be defined as a group of people with specific roles and complementary talents and skills, aligned with and committed to a common purpose, which consistently show high levels of collaboration and innovation that produce superior results. (Hanlan, 2004). The high-performance team has individuals who are highly skilled and are able to interchange their roles and are flexible. Our team operated in this exact manner and had positive outcomes. By definition, this is a good description of our team. Teams that are successful translate their common purpose into specific, measurable, and realistic performance goals. Specific goals facilitate clear communication and help teams maintain their focus on obtaining results (Robbins & Judge, 2009). Our time lines that we discussed on the conference call set clear goals and challenged the group to make sure that we left enough time for Amber to review the work and complete her section. Difficult goals have been found to raise the performance of team members especially to avoid letting down another member of the team (Robbins & Judge, 2009). Forming teams is almost always more productive than having people work by themselves (Cameron, Quinn, Degraff, & Thakor, 2006). This is very true when you have a team like ours that was very collaborative throughout the entire process. Because we were able to work independently, we are able to bring our own ideas to our assigned sections. Many new ideas come from individuals being given the time and resources and allowed to work apart from the normal activities of the organization (Cameron, Quinn, Degraff, & Thakor, 2006) Team Grade: As a team, we have agreed that our work qualifies for a minimum of an A-. We completed the project as assigned. It is our belief we met the challenge of this project by applying the tools of this class successfully. Through organization, structure, communication, role defining and proactivity, we were able to avoid conflict and complete this project on time and in good quality. Our established set of norms that exist within the graduate structure of this class set a good base for the team members to start from. Our team led the class in team creation before the professor was able to clarify the approach. We consider ourselves leaders. We are sure the paper isn’t perfect, no product from any working team is. But what it IS, is a successful compilation of teamwork. SUMMARY: Apple Inc. is a perfect company to analyze through the human behavior lens because their founders understood and structured their company with human behavior in mind. They considered their people and the behaviors that were desired, but they also pay close attention to the consumers and their behaviors. Jobs maintained a company by building a structure, culture, set of norms and values that fostered creativity. He was a genius of people and technology. Jobs did this at apple under 7 rules of success (his norms/values). Rule one is passion, because most people fail because they don’t love what they do. Rule number two is build a team of great people, success hinges on the ability to identify talent and the know how of building successful teams. Rule number three is vision. One must never lose sight of the big picture. Rule number four is creativity; you have to think outside of the box in business and in practice. Rule number five is to learn to say no more often. It’s all about the power of focus. Rule number six is help customers reach their dreams. If you don’t solve a problem, if you don’t accomplish a dream, you don’t have a business. Finally, work on your marketing message (communication externally). Trumpet your success and deliver it in a way people want to hear about it. Don’t be the norm or fill the status quo. (Gallo, 14 O) Steve Jobs says â€Å"Apple is an incredible collaborative company.† Did you know that? Do you by chance know how many committees they have at Apple? ZERO! Teamwork is key to Apple. Teamwork, in terms of trusting that people that will deliver what they committed to without watching them all the time. Jobs set up a training environment that taught his people about people and how to interact with them and get them to achieve the desired result (sales). There is a cult like following not only because of the quality of product, but because of the great care the leaders at Apple took to create and maintain their company in a way that considers (and possibly manipulates) human behavior. Recommendations for Apple Inc. are a bit more complex. With Jobs passing, Tim Cook is just starting to get his feet wet in running and driving the company. Consumers and employees have a high expectation for apple. In terms of structure and communication, roles and culture, it seems Apple is a leader. It will continue to be important for Apple to define that fine line between taking advantage of their knowledge of human behavior and manipulating it for strictly gain. Their technology has also been a leader in the industry. However they have many competitors who are catching up and arguably, surpassing them. The question will be how so they stay ahead and keep their creative people happy. It may require a new out of the box thinking. With new leadership in Cook, it is likely that there will be changes. He will have to establish himself with his people and his consumers who so loved his predecessor. References Cameron, K. S., Quinn, R. E., Degraff, J., & Thakor, A. V. (2006). Competing Values Leadership. Northampton: Edward Elgar Publishing. Greenwald, H. P. (2008). Organizations. Management Without Control. Thousand Oaks: Sage. Hanlan, M. (2004). High Performance Teams. Westport: Praeger Publishers. Robbins, S. P., & Judge, T. A. (2009). Organizational Behavior. Upper Saddle River: Pearson Prentice Hall. All Things D. (2012, May 25). Mobile devices now make up about 20 percent of U.S. web traffice. Retrieved from AllthingsD.com: http://allthingsd.com/20120525/mobile-devices-now-make-up-about-20-percent-of-u-s-web-traffic/ Apple. (2012, December 9). Apple Press Info. Retrieved from Apple.com: http://www.apple.com/pr/bios/ Apple Inc. (2012, December 9). Investors Relaitons. Retrieved from Apple.com: http://investor.apple.com/financials.cfm MSNBC. (2012, December 7). Rock Center – Apple CEO on challenge of keeping company cutting edge. Retrieved from Video.msnbc: http://video.msnbc.ms n.com/rock-center/50112247#50112247 Washington Post. (2012, December 9). Apple: A history of one of the world’s most valuable companies. Retrieved from Washingtonpost.com: http://www.washingtonpost.com/business/economy/apple-a-history-of-one-of-the-worlds-most-valuable-companies/2012/02/29/gIQA1VFVmR_gallery.html#photo=1 Don Reisinger (2010) Apple’s Corporate Culture: 10 Lessons for Staying in Steve Good Graces, Enterprise IT Technology News, retrieved from: http://www.eweek.com/c/a/IT-Infrastructure/Apples-Corporate-Culture-10-Lessons-for-Staying-in-Steve-Jobs-Good-Graces-825505/